EMAIL THIS PAGE TO A FRIEND

MMRN2

multimerin 2

47 Gene Product Result for
Synonyms: EMILIN-3 EMILIN3 ENDOGLYX-1
UniProtKB ID: Q9H8L6, Q504V7, Q6P2N2
Gene ID:
Human(79812) Summary: This gene encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transforming growth factor beta antagonist and can interfere with the VEGF-A/VEGFR2 pathway. A related pseudogene has been identified on chromosome 6. [provided by RefSeq, Aug 2012]
Mouse(105450) multimerin 2
Rat(306288) multimerin 2
sheep(101112788) multimerin 2
chicken(423611) multimerin 2
cow(512308) multimerin 2
dog(489078) multimerin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024756 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024756 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024756 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153127 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153127 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153127 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024756 Rosetta Predictions human pricing
NM_001107298 Rosetta Predictions rat pricing
NM_153127 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167677 predicted 1338
2 SASI_Hs01_00167678 predicted 2829
3 SASI_Hs01_00167679 predicted 1542
4 SASI_Hs01_00167680 predicted 386
5 SASI_Hs02_00357258 predicted 1329
6 SASI_Hs01_00167681 predicted 2674
7 SASI_Hs01_00167682 predicted 1270
8 SASI_Hs01_00167683 predicted 2471
9 SASI_Hs01_00167685 predicted 838
10 SASI_Hs01_00167686 predicted 2839
11 SASI_Hs01_00167684 predicted 2679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107298 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227465 predicted 2430
2 SASI_Rn02_00227466 predicted 2425
3 SASI_Rn02_00227467 predicted 2403
4 SASI_Rn02_00227468 predicted 1409
5 SASI_Rn02_00227469 predicted 1899
6 SASI_Rn02_00227470 predicted 1306
7 SASI_Rn02_00227471 predicted 2745
8 SASI_Rn02_00227472 predicted 2198
9 SASI_Rn02_00227473 predicted 2306
10 SASI_Rn02_00227474 predicted 2432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153127 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342995 predicted 2955
2 SASI_Mm01_00130930 predicted 331
3 SASI_Mm01_00130933 predicted 764
4 SASI_Mm01_00130934 predicted 677
5 SASI_Mm02_00342996 predicted 2694
6 SASI_Mm01_00130935 predicted 919
7 SASI_Mm01_00130936 predicted 419
8 SASI_Mm01_00130937 predicted 910
9 SASI_Mm01_00130938 predicted 2146
10 SASI_Mm02_00342997 predicted 2399
11 SASI_Mm01_00130931 predicted 315
12 SASI_Mm01_00130932 predicted 303
13 SASI_Mm01_00130939 predicted 746
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024756
MMRN2 MISSION shRNA Bacterial Glycerol Stock
multimerin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-1523s1c1
Sequence:CCGGCGACCTCATCAAGTACGTGAACTCGAGTTCACGTACTTGATGAGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-342s1c1
Sequence:CCGGCCAGACTGCCAGAAAGTCAAACTCGAGTTTGACTTTCTGGCAGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-2600s1c1
Sequence:CCGGGAAGTTCAACACCACATACATCTCGAGATGTATGTGGTGTTGAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-700s1c1
Sequence:CCGGCAGTGATGGAAGCAAATCAAACTCGAGTTTGATTTGCTTCCATCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-564s1c1
Sequence:CCGGGCTGCAGTGATCAATGAGGTTCTCGAGAACCTCATTGATCACTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-2854s1c1
Sequence:CCGGCCCAGGGATCAATAACAAAGACTCGAGTCTTTGTTATTGATCCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-1067s1c1
Sequence:CCGGCGATGTGGACACCAAATTGAACTCGAGTTCAATTTGGTGTCCACATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024756.2-1386s21c1
Sequence:CCGGACGAGACTTTCGATCAGATTACTCGAGTAATCTGATCGAAAGTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024756.2-1602s21c1
Sequence:CCGGGCAATTGCCAGAAGCTCTATTCTCGAGAATAGAGCTTCTGGCAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024756.2-2900s21c1
Sequence:CCGGGAGTTAACCCAGGGATCAATACTCGAGTATTGATCCCTGGGTTAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024756
MMRN2 MISSION shRNA shRNA Plasmid DNA
multimerin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-1523s1c1
Sequence:CCGGCGACCTCATCAAGTACGTGAACTCGAGTTCACGTACTTGATGAGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-342s1c1
Sequence:CCGGCCAGACTGCCAGAAAGTCAAACTCGAGTTTGACTTTCTGGCAGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-2600s1c1
Sequence:CCGGGAAGTTCAACACCACATACATCTCGAGATGTATGTGGTGTTGAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-700s1c1
Sequence:CCGGCAGTGATGGAAGCAAATCAAACTCGAGTTTGATTTGCTTCCATCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-564s1c1
Sequence:CCGGGCTGCAGTGATCAATGAGGTTCTCGAGAACCTCATTGATCACTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-2854s1c1
Sequence:CCGGCCCAGGGATCAATAACAAAGACTCGAGTCTTTGTTATTGATCCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-1067s1c1
Sequence:CCGGCGATGTGGACACCAAATTGAACTCGAGTTCAATTTGGTGTCCACATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024756.2-1386s21c1
Sequence:CCGGACGAGACTTTCGATCAGATTACTCGAGTAATCTGATCGAAAGTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024756.2-1602s21c1
Sequence:CCGGGCAATTGCCAGAAGCTCTATTCTCGAGAATAGAGCTTCTGGCAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024756.2-2900s21c1
Sequence:CCGGGAGTTAACCCAGGGATCAATACTCGAGTATTGATCCCTGGGTTAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024756
MMRN2 MISSION shRNA Lentiviral Transduction Particles
multimerin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-1523s1c1
Sequence:CCGGCGACCTCATCAAGTACGTGAACTCGAGTTCACGTACTTGATGAGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-342s1c1
Sequence:CCGGCCAGACTGCCAGAAAGTCAAACTCGAGTTTGACTTTCTGGCAGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-2600s1c1
Sequence:CCGGGAAGTTCAACACCACATACATCTCGAGATGTATGTGGTGTTGAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-700s1c1
Sequence:CCGGCAGTGATGGAAGCAAATCAAACTCGAGTTTGATTTGCTTCCATCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-564s1c1
Sequence:CCGGGCTGCAGTGATCAATGAGGTTCTCGAGAACCTCATTGATCACTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-2854s1c1
Sequence:CCGGCCCAGGGATCAATAACAAAGACTCGAGTCTTTGTTATTGATCCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024756.1-1067s1c1
Sequence:CCGGCGATGTGGACACCAAATTGAACTCGAGTTCAATTTGGTGTCCACATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024756.2-1386s21c1
Sequence:CCGGACGAGACTTTCGATCAGATTACTCGAGTAATCTGATCGAAAGTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024756.2-1602s21c1
Sequence:CCGGGCAATTGCCAGAAGCTCTATTCTCGAGAATAGAGCTTCTGGCAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024756.2-2900s21c1
Sequence:CCGGGAGTTAACCCAGGGATCAATACTCGAGTATTGATCCCTGGGTTAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153127
MMRN2 MISSION shRNA Bacterial Glycerol Stock
multimerin 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153127.2-579s1c1
Sequence:CCGGCCCAGAGTTTAATGAGATTAACTCGAGTTAATCTCATTAAACTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153127.2-2414s1c1
Sequence:CCGGCCATGTTGAGTAAGAAAGATACTCGAGTATCTTTCTTACTCAACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153127.2-719s1c1
Sequence:CCGGCAGAAGCCAATCTAACAGAATCTCGAGATTCTGTTAGATTGGCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153127.3-2854s21c1
Sequence:CCGGAGAGCGTGGTTTGAGTTAATCCTCGAGGATTAACTCAAACCACGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153127.3-3539s21c1
Sequence:CCGGAGCCAACACATGGTTGAATTACTCGAGTAATTCAACCATGTGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153127.3-1443s21c1
Sequence:CCGGAGAGCTGCGGGTGATCCTAATCTCGAGATTAGGATCACCCGCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153127.3-1104s21c1
Sequence:CCGGTGAGGTGAGCACCAAGTTAAACTCGAGTTTAACTTGGTGCTCACCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153127.3-1550s21c1
Sequence:CCGGCGGGTCATGCAGACCTCATTACTCGAGTAATGAGGTCTGCATGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153127
MMRN2 MISSION shRNA shRNA Plasmid DNA
multimerin 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153127.2-579s1c1
Sequence:CCGGCCCAGAGTTTAATGAGATTAACTCGAGTTAATCTCATTAAACTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153127.2-2414s1c1
Sequence:CCGGCCATGTTGAGTAAGAAAGATACTCGAGTATCTTTCTTACTCAACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153127.2-719s1c1
Sequence:CCGGCAGAAGCCAATCTAACAGAATCTCGAGATTCTGTTAGATTGGCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153127.3-2854s21c1
Sequence:CCGGAGAGCGTGGTTTGAGTTAATCCTCGAGGATTAACTCAAACCACGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153127.3-3539s21c1
Sequence:CCGGAGCCAACACATGGTTGAATTACTCGAGTAATTCAACCATGTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153127.3-1443s21c1
Sequence:CCGGAGAGCTGCGGGTGATCCTAATCTCGAGATTAGGATCACCCGCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153127.3-1104s21c1
Sequence:CCGGTGAGGTGAGCACCAAGTTAAACTCGAGTTTAACTTGGTGCTCACCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153127.3-1550s21c1
Sequence:CCGGCGGGTCATGCAGACCTCATTACTCGAGTAATGAGGTCTGCATGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153127
MMRN2 MISSION shRNA Lentiviral Transduction Particles
multimerin 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153127.2-579s1c1
Sequence:CCGGCCCAGAGTTTAATGAGATTAACTCGAGTTAATCTCATTAAACTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153127.2-2414s1c1
Sequence:CCGGCCATGTTGAGTAAGAAAGATACTCGAGTATCTTTCTTACTCAACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153127.2-719s1c1
Sequence:CCGGCAGAAGCCAATCTAACAGAATCTCGAGATTCTGTTAGATTGGCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153127.3-2854s21c1
Sequence:CCGGAGAGCGTGGTTTGAGTTAATCCTCGAGGATTAACTCAAACCACGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153127.3-3539s21c1
Sequence:CCGGAGCCAACACATGGTTGAATTACTCGAGTAATTCAACCATGTGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153127.3-1443s21c1
Sequence:CCGGAGAGCTGCGGGTGATCCTAATCTCGAGATTAGGATCACCCGCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153127.3-1104s21c1
Sequence:CCGGTGAGGTGAGCACCAAGTTAAACTCGAGTTTAACTTGGTGCTCACCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153127.3-1550s21c1
Sequence:CCGGCGGGTCATGCAGACCTCATTACTCGAGTAATGAGGTCTGCATGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)