EMAIL THIS PAGE TO A FRIEND

MMS19

MMS19 nucleotide excision repair homolog (S. cerevisiae)

41 Gene Product Result for
Synonyms: MET18 MMS19L hMMS19
Gene ID:
Mouse(72199) MMS19 (MET18 S. cerevisiae)
Zebrafish(563643) MMS19 nucleotide excision repair homolog (S. cerevisiae)
fruit fly(40626) CG12005 gene product from transcript CG12005-RB
cow(533499) MMS19 nucleotide excision repair homolog (S. cerevisiae)
Horse(100070717) MMS19 nucleotide excision repair homolog (S. cerevisiae)
domestic cat(101100338) MMS19 nucleotide excision repair homolog (S. cerevisiae)
dog(477788) MMS19 nucleotide excision repair homolog (S. cerevisiae)
chicken(423842) MMS19 nucleotide excision repair homolog (S. cerevisiae)
sheep(101114322) MMS19 nucleotide excision repair homolog (S. cerevisiae)
domestic guinea pig(100720211) MMS19 nucleotide excision repair homolog (S. cerevisiae)
naked mole-rat(101726454) MMS19 nucleotide excision repair homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022362 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028152 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028152 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028152 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022362 Rosetta Predictions human pricing
NM_028152 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038246 predicted 843
2 SASI_Hs01_00038247 predicted 1898
3 SASI_Hs01_00038248 predicted 2364
4 SASI_Hs01_00038249 predicted 495
5 SASI_Hs01_00038250 predicted 876
6 SASI_Hs01_00038251 predicted 1531
7 SASI_Hs02_00355658 predicted 345
8 SASI_Hs02_00355659 predicted 2423
9 SASI_Hs01_00038254 predicted 822
10 SASI_Hs02_00355660 predicted 2615
11 SASI_Hs01_00038252 predicted 2643
12 SASI_Hs01_00038253 predicted 533
13 SASI_Hs01_00038255 predicted 2249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028152 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043371 predicted 462
2 SASI_Mm01_00043372 predicted 2853
3 SASI_Mm01_00043373 predicted 1629
4 SASI_Mm01_00043374 predicted 2442
5 SASI_Mm02_00333430 predicted 582
6 SASI_Mm01_00043375 predicted 812
7 SASI_Mm01_00043376 predicted 1123
8 SASI_Mm01_00043377 predicted 2408
9 SASI_Mm01_00043378 predicted 1317
10 SASI_Mm01_00043379 predicted 1096
11 SASI_Mm01_00043380 predicted 665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022362
VALIDATED
MMS19 MISSION shRNA Bacterial Glycerol Stock
MMS19 nucleotide excision repair homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022362.4-2361s21c1
Sequence:CCGGGCGGCTGATTGCACTGCTTATCTCGAGATAAGCAGTGCAATCAGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022362.4-882s21c1
Sequence:CCGGCTGTTATTTCCCTATCGATTTCTCGAGAAATCGATAGGGAAATAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022362.4-3471s21c1
Sequence:CCGGAGAACATAAGAGTCCATATTTCTCGAGAAATATGGACTCTTATGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022362.4-1993s21c1
Sequence:CCGGGCACAATCCAGTGACGTTATTCTCGAGAATAACGTCACTGGATTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022362.2-3351s1c1
Sequence:CCGGCCTGGGTCTCTTGCATTTATACTCGAGTATAAATGCAAGAGACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022362.2-1303s1c1
Sequence:CCGGTGGAGCTATGAAGACAAAGATCTCGAGATCTTTGTCTTCATAGCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022362.2-465s1c1
Sequence:CCGGCCGACACACAGTCTACAATATCTCGAGATATTGTAGACTGTGTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_022362.2-2196s1c1
Sequence:CCGGCCTGCCTCGAAATGTGGAAATCTCGAGATTTCCACATTTCGAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022362.2-2619s1c1
Sequence:CCGGCCAGCGGTTCTTCACAGATAACTCGAGTTATCTGTGAAGAACCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022362
VALIDATED
MMS19 MISSION shRNA shRNA Plasmid DNA
MMS19 nucleotide excision repair homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022362.4-2361s21c1
Sequence:CCGGGCGGCTGATTGCACTGCTTATCTCGAGATAAGCAGTGCAATCAGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022362.4-882s21c1
Sequence:CCGGCTGTTATTTCCCTATCGATTTCTCGAGAAATCGATAGGGAAATAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022362.4-3471s21c1
Sequence:CCGGAGAACATAAGAGTCCATATTTCTCGAGAAATATGGACTCTTATGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022362.4-1993s21c1
Sequence:CCGGGCACAATCCAGTGACGTTATTCTCGAGAATAACGTCACTGGATTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022362.2-3351s1c1
Sequence:CCGGCCTGGGTCTCTTGCATTTATACTCGAGTATAAATGCAAGAGACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022362.2-1303s1c1
Sequence:CCGGTGGAGCTATGAAGACAAAGATCTCGAGATCTTTGTCTTCATAGCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022362.2-465s1c1
Sequence:CCGGCCGACACACAGTCTACAATATCTCGAGATATTGTAGACTGTGTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_022362.2-2196s1c1
Sequence:CCGGCCTGCCTCGAAATGTGGAAATCTCGAGATTTCCACATTTCGAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022362.2-2619s1c1
Sequence:CCGGCCAGCGGTTCTTCACAGATAACTCGAGTTATCTGTGAAGAACCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022362
VALIDATED
MMS19 MISSION shRNA Lentiviral Transduction Particles
MMS19 nucleotide excision repair homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022362.4-2361s21c1
Sequence:CCGGGCGGCTGATTGCACTGCTTATCTCGAGATAAGCAGTGCAATCAGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022362.4-882s21c1
Sequence:CCGGCTGTTATTTCCCTATCGATTTCTCGAGAAATCGATAGGGAAATAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022362.4-3471s21c1
Sequence:CCGGAGAACATAAGAGTCCATATTTCTCGAGAAATATGGACTCTTATGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022362.4-1993s21c1
Sequence:CCGGGCACAATCCAGTGACGTTATTCTCGAGAATAACGTCACTGGATTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022362.2-3351s1c1
Sequence:CCGGCCTGGGTCTCTTGCATTTATACTCGAGTATAAATGCAAGAGACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022362.2-1303s1c1
Sequence:CCGGTGGAGCTATGAAGACAAAGATCTCGAGATCTTTGTCTTCATAGCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022362.2-465s1c1
Sequence:CCGGCCGACACACAGTCTACAATATCTCGAGATATTGTAGACTGTGTGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_022362.2-2196s1c1
Sequence:CCGGCCTGCCTCGAAATGTGGAAATCTCGAGATTTCCACATTTCGAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022362.2-2619s1c1
Sequence:CCGGCCAGCGGTTCTTCACAGATAACTCGAGTTATCTGTGAAGAACCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028152
VALIDATED
MMS19 MISSION shRNA Bacterial Glycerol Stock
MMS19 nucleotide excision repair homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028152.3-708s21c1
Sequence:CCGGCCTCCGCCTAACGATCCTTATCTCGAGATAAGGATCGTTAGGCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028152.3-139s21c1
Sequence:CCGGATGTGAAGTCCGGTGGCTATACTCGAGTATAGCCACCGGACTTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028152.3-3441s21c1
Sequence:CCGGCCAGAGAATAAAGCCTTCTTTCTCGAGAAAGAAGGCTTTATTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028152.3-1862s21c1
Sequence:CCGGCCCTGAGAGCTACTGGTATTTCTCGAGAAATACCAGTAGCTCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028152.3-1253s21c1
Sequence:CCGGGCGTCGGACAATCCTTGAAATCTCGAGATTTCAAGGATTGTCCGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028152.2-3441s1c1
Sequence:CCGGCCAGAGAATAAAGCCTTCTTTCTCGAGAAAGAAGGCTTTATTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028152.2-1253s1c1
Sequence:CCGGGCGTCGGACAATCCTTGAAATCTCGAGATTTCAAGGATTGTCCGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028152.2-2198s1c1
Sequence:CCGGCCTGCCACGAAATGTGGAAATCTCGAGATTTCCACATTTCGTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028152.2-1862s1c1
Sequence:CCGGCCCTGAGAGCTACTGGTATTTCTCGAGAAATACCAGTAGCTCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028152.2-2996s1c1
Sequence:CCGGGCCATACAAATCTCAGGTCATCTCGAGATGACCTGAGATTTGTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028152
VALIDATED
MMS19 MISSION shRNA shRNA Plasmid DNA
MMS19 nucleotide excision repair homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028152.3-708s21c1
Sequence:CCGGCCTCCGCCTAACGATCCTTATCTCGAGATAAGGATCGTTAGGCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028152.3-139s21c1
Sequence:CCGGATGTGAAGTCCGGTGGCTATACTCGAGTATAGCCACCGGACTTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028152.3-3441s21c1
Sequence:CCGGCCAGAGAATAAAGCCTTCTTTCTCGAGAAAGAAGGCTTTATTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028152.3-1862s21c1
Sequence:CCGGCCCTGAGAGCTACTGGTATTTCTCGAGAAATACCAGTAGCTCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028152.3-1253s21c1
Sequence:CCGGGCGTCGGACAATCCTTGAAATCTCGAGATTTCAAGGATTGTCCGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028152.2-3441s1c1
Sequence:CCGGCCAGAGAATAAAGCCTTCTTTCTCGAGAAAGAAGGCTTTATTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028152.2-1253s1c1
Sequence:CCGGGCGTCGGACAATCCTTGAAATCTCGAGATTTCAAGGATTGTCCGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028152.2-2198s1c1
Sequence:CCGGCCTGCCACGAAATGTGGAAATCTCGAGATTTCCACATTTCGTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028152.2-1862s1c1
Sequence:CCGGCCCTGAGAGCTACTGGTATTTCTCGAGAAATACCAGTAGCTCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028152.2-2996s1c1
Sequence:CCGGGCCATACAAATCTCAGGTCATCTCGAGATGACCTGAGATTTGTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028152
VALIDATED
MMS19 MISSION shRNA Lentiviral Transduction Particles
MMS19 nucleotide excision repair homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028152.3-708s21c1
Sequence:CCGGCCTCCGCCTAACGATCCTTATCTCGAGATAAGGATCGTTAGGCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028152.3-139s21c1
Sequence:CCGGATGTGAAGTCCGGTGGCTATACTCGAGTATAGCCACCGGACTTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028152.3-3441s21c1
Sequence:CCGGCCAGAGAATAAAGCCTTCTTTCTCGAGAAAGAAGGCTTTATTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028152.3-1862s21c1
Sequence:CCGGCCCTGAGAGCTACTGGTATTTCTCGAGAAATACCAGTAGCTCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028152.3-1253s21c1
Sequence:CCGGGCGTCGGACAATCCTTGAAATCTCGAGATTTCAAGGATTGTCCGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028152.2-3441s1c1
Sequence:CCGGCCAGAGAATAAAGCCTTCTTTCTCGAGAAAGAAGGCTTTATTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028152.2-1253s1c1
Sequence:CCGGGCGTCGGACAATCCTTGAAATCTCGAGATTTCAAGGATTGTCCGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028152.2-2198s1c1
Sequence:CCGGCCTGCCACGAAATGTGGAAATCTCGAGATTTCCACATTTCGTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028152.2-1862s1c1
Sequence:CCGGCCCTGAGAGCTACTGGTATTTCTCGAGAAATACCAGTAGCTCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028152.2-2996s1c1
Sequence:CCGGGCCATACAAATCTCAGGTCATCTCGAGATGACCTGAGATTTGTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)