EMAIL THIS PAGE TO A FRIEND

MMS22L

MMS22-like, DNA repair protein

80 Gene Product Result for
Synonyms: C6orf167 dJ39B17.2
Gene ID:
Mouse(212377) MMS22-like, DNA repair protein
Rat(313108) MMS22-like, DNA repair protein
domestic guinea pig(100734427) MMS22-like, DNA repair protein
naked mole-rat(101718280) MMS22-like, DNA repair protein
sheep(101105004) MMS22-like, DNA repair protein
Zebrafish(563411) MMS22-like, DNA repair protein
chicken(421799) MMS22-like, DNA repair protein
cow(532916) MMS22-like, DNA repair protein
domestic cat(101082910) MMS22-like, DNA repair protein
dog(481930) MMS22-like, DNA repair protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198468 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199467 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199467 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199467 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198468 Rosetta Predictions human pricing
XM_232837 Rosetta Predictions rat pricing
XR_007844 Rosetta Predictions rat pricing
NM_199467 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371998 predicted 1015
2 SASI_Hs01_00122939 predicted 1010
3 SASI_Hs02_00371999 predicted 568
4 SASI_Hs01_00122940 predicted 3346
5 SASI_Hs01_00122941 predicted 3157
6 SASI_Hs02_00372000 predicted 3430
7 SASI_Hs01_00122942 predicted 1665
8 SASI_Hs01_00122945 predicted 1065
9 SASI_Hs02_00372001 predicted 1469
10 SASI_Hs01_00122947 predicted 3008
11 SASI_Hs01_00122938 predicted 2502
12 SASI_Hs01_00122943 predicted 3641
13 SASI_Hs01_00122944 predicted 588
14 SASI_Hs01_00122946 predicted 2760
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232837 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387275 predicted 618
2 SASI_Rn02_00387276 predicted 671
3 SASI_Rn02_00387277 predicted 694
4 SASI_Rn02_00387278 predicted 595
5 SASI_Rn02_00387279 predicted 583
6 SASI_Rn02_00387280 predicted 528
7 SASI_Rn02_00387281 predicted 654
8 SASI_Rn02_00387282 predicted 662
9 SASI_Rn02_00387283 predicted 597
10 SASI_Rn02_00387284 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007844 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168695 predicted 3916
2 SASI_Rn01_00168696 predicted 3012
3 SASI_Rn02_00415614 predicted 962
4 SASI_Rn02_00415615 predicted 597
5 SASI_Rn01_00168697 predicted 317
6 SASI_Rn01_00168698 predicted 3105
7 SASI_Rn01_00168700 predicted 2652
8 SASI_Rn01_00168701 predicted 1445
9 SASI_Rn01_00168702 predicted 3243
10 SASI_Rn02_00415616 predicted 3315
11 SASI_Rn01_00168699 predicted 2712
12 SASI_Rn01_00168703 predicted 3190
13 SASI_Rn01_00168704 predicted 3546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199467 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174390 predicted 2414
2 SASI_Mm01_00174391 predicted 568
3 SASI_Mm01_00174392 predicted 709
4 SASI_Mm01_00174393 predicted 2398
5 SASI_Mm01_00174394 predicted 610
6 SASI_Mm01_00174395 predicted 1925
7 SASI_Mm01_00174396 predicted 2017
8 SASI_Mm01_00174397 predicted 3069
9 SASI_Mm01_00174398 predicted 2572
10 SASI_Mm02_00351474 predicted 1513
11 SASI_Mm01_00174389 predicted 1211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198468
MMS22L MISSION shRNA Bacterial Glycerol Stock
MMS22-like, DNA repair protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198468.2-446s21c1
Sequence:CCGGTGACCCTTTACCAACTAATTTCTCGAGAAATTAGTTGGTAAAGGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-785s1c1
Sequence:CCGGGCTTCATGGATTACTCTTGTACTCGAGTACAAGAGTAATCCATGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-3557s1c1
Sequence:CCGGCCAACTCTTCAAGGAAACTAACTCGAGTTAGTTTCCTTGAAGAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-2607s1c1
Sequence:CCGGCCTCAAGTTGTAGCAAGATATCTCGAGATATCTTGCTACAACTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-1073s1c1
Sequence:CCGGGTCACTCAACAGGTACGACAACTCGAGTTGTCGTACCTGTTGAGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-829s1c1
Sequence:CCGGCCAGTGTTAATATAGGAGCATCTCGAGATGCTCCTATATTAACACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198468.2-1654s21c1
Sequence:CCGGAGACTTGCTGTTGCGATAAACCTCGAGGTTTATCGCAACAGCAAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-3228s1c1
Sequence:CCGGGCACCTATGTTGTCAGCAATTCTCGAGAATTGCTGACAACATAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198468.1-4051s1c1
Sequence:CCGGGTTCCACTCTAATTCCTACTTCTCGAGAAGTAGGAATTAGAGTGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-2185s1c1
Sequence:CCGGGCTTGTATCCTTCCCATGAAACTCGAGTTTCATGGGAAGGATACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198468
MMS22L MISSION shRNA shRNA Plasmid DNA
MMS22-like, DNA repair protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198468.2-446s21c1
Sequence:CCGGTGACCCTTTACCAACTAATTTCTCGAGAAATTAGTTGGTAAAGGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-785s1c1
Sequence:CCGGGCTTCATGGATTACTCTTGTACTCGAGTACAAGAGTAATCCATGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-3557s1c1
Sequence:CCGGCCAACTCTTCAAGGAAACTAACTCGAGTTAGTTTCCTTGAAGAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-2607s1c1
Sequence:CCGGCCTCAAGTTGTAGCAAGATATCTCGAGATATCTTGCTACAACTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-1073s1c1
Sequence:CCGGGTCACTCAACAGGTACGACAACTCGAGTTGTCGTACCTGTTGAGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-829s1c1
Sequence:CCGGCCAGTGTTAATATAGGAGCATCTCGAGATGCTCCTATATTAACACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198468.2-1654s21c1
Sequence:CCGGAGACTTGCTGTTGCGATAAACCTCGAGGTTTATCGCAACAGCAAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-3228s1c1
Sequence:CCGGGCACCTATGTTGTCAGCAATTCTCGAGAATTGCTGACAACATAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198468.1-4051s1c1
Sequence:CCGGGTTCCACTCTAATTCCTACTTCTCGAGAAGTAGGAATTAGAGTGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-2185s1c1
Sequence:CCGGGCTTGTATCCTTCCCATGAAACTCGAGTTTCATGGGAAGGATACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198468
MMS22L MISSION shRNA Lentiviral Transduction Particles
MMS22-like, DNA repair protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198468.2-446s21c1
Sequence:CCGGTGACCCTTTACCAACTAATTTCTCGAGAAATTAGTTGGTAAAGGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-785s1c1
Sequence:CCGGGCTTCATGGATTACTCTTGTACTCGAGTACAAGAGTAATCCATGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-3557s1c1
Sequence:CCGGCCAACTCTTCAAGGAAACTAACTCGAGTTAGTTTCCTTGAAGAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-2607s1c1
Sequence:CCGGCCTCAAGTTGTAGCAAGATATCTCGAGATATCTTGCTACAACTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-1073s1c1
Sequence:CCGGGTCACTCAACAGGTACGACAACTCGAGTTGTCGTACCTGTTGAGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-829s1c1
Sequence:CCGGCCAGTGTTAATATAGGAGCATCTCGAGATGCTCCTATATTAACACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198468.2-1654s21c1
Sequence:CCGGAGACTTGCTGTTGCGATAAACCTCGAGGTTTATCGCAACAGCAAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-3228s1c1
Sequence:CCGGGCACCTATGTTGTCAGCAATTCTCGAGAATTGCTGACAACATAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198468.1-4051s1c1
Sequence:CCGGGTTCCACTCTAATTCCTACTTCTCGAGAAGTAGGAATTAGAGTGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198468.1-2185s1c1
Sequence:CCGGGCTTGTATCCTTCCCATGAAACTCGAGTTTCATGGGAAGGATACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199467
VALIDATED
MMS22L MISSION shRNA Bacterial Glycerol Stock
MMS22-like, DNA repair protein
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000181647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199467.1-1674s1c1
Sequence:CCGGGCAGTCTTCATTATCGGCTAACTCGAGTTAGCCGATAATGAAGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199467.1-3367s1c1
Sequence:CCGGCCAGCTGCTACTGTGATTAATCTCGAGATTAATCACAGTAGCAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199467.1-3069s1c1
Sequence:CCGGCCAGGACTATGGTATGCAATACTCGAGTATTGCATACCATAGTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199467.1-1553s1c1
Sequence:CCGGCCTGTCGAGAATCTGAACTTACTCGAGTAAGTTCAGATTCTCGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199467
VALIDATED
MMS22L MISSION shRNA shRNA Plasmid DNA
MMS22-like, DNA repair protein
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000181647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199467.1-1674s1c1
Sequence:CCGGGCAGTCTTCATTATCGGCTAACTCGAGTTAGCCGATAATGAAGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199467.1-3367s1c1
Sequence:CCGGCCAGCTGCTACTGTGATTAATCTCGAGATTAATCACAGTAGCAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199467.1-3069s1c1
Sequence:CCGGCCAGGACTATGGTATGCAATACTCGAGTATTGCATACCATAGTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199467.1-1553s1c1
Sequence:CCGGCCTGTCGAGAATCTGAACTTACTCGAGTAAGTTCAGATTCTCGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199467
VALIDATED
MMS22L MISSION shRNA Lentiviral Transduction Particles
MMS22-like, DNA repair protein
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000181647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199467.1-1674s1c1
Sequence:CCGGGCAGTCTTCATTATCGGCTAACTCGAGTTAGCCGATAATGAAGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199467.1-3367s1c1
Sequence:CCGGCCAGCTGCTACTGTGATTAATCTCGAGATTAATCACAGTAGCAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199467.1-3069s1c1
Sequence:CCGGCCAGGACTATGGTATGCAATACTCGAGTATTGCATACCATAGTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199467.1-1553s1c1
Sequence:CCGGCCTGTCGAGAATCTGAACTTACTCGAGTAAGTTCAGATTCTCGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)