EMAIL THIS PAGE TO A FRIEND

MN1

meningioma (disrupted in balanced translocation) 1

149 Gene Product Result for
Synonyms: MGCR MGCR1 MGCR1-PEN dJ353E16.2
UniProtKB ID: Q10571, A9Z1V9
Gene ID:
Human(4330) Summary: Meningioma 1 (MN1) contains two sets of CAG repeats. It is disrupted by a balanced translocation (4;22) in a meningioma, and its inactivation may contribute to meningioma 32 pathogenesis. [provided by RefSeq, Jul 2008]
Mouse(433938) meningioma 1
Rat(498194) meningioma 1
cow(786290) meningioma (disrupted in balanced translocation) 1
Horse(100059357) meningioma (disrupted in balanced translocation) 1
domestic cat(101091407) meningioma (disrupted in balanced translocation) 1
dog(486335) meningioma (disrupted in balanced translocation) 1
sheep(101119165) meningioma (disrupted in balanced translocation) 1
naked mole-rat(101719108) meningioma (disrupted in balanced translocation) 1
domestic guinea pig(100721101) meningioma (disrupted in balanced translocation) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002430 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081235 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081235 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081235 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121991 MISSION® esiRNA esiRNA human MN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002430 Rosetta Predictions human pricing
XM_001080607 Rosetta Predictions rat pricing
XM_573413 Rosetta Predictions rat pricing
NM_001081235 Rosetta Predictions mouse pricing
XM_485667 Rosetta Predictions mouse pricing
XM_901656 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153555 predicted 4091
2 SASI_Hs01_00153556 predicted 4179
3 SASI_Hs01_00153557 predicted 4526
4 SASI_Hs01_00153558 predicted 3480
5 SASI_Hs01_00153559 predicted 1033
6 SASI_Hs01_00153560 predicted 1407
7 SASI_Hs01_00153561 predicted 1010
8 SASI_Hs01_00153562 predicted 4564
9 SASI_Hs01_00153563 predicted 1130
10 SASI_Hs01_00153564 predicted 2835
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368620 predicted 2494
2 SASI_Rn02_00368621 predicted 3102
3 SASI_Rn02_00368622 predicted 3054
4 SASI_Rn02_00368623 predicted 2357
5 SASI_Rn02_00368624 predicted 581
6 SASI_Rn02_00368625 predicted 2744
7 SASI_Rn02_00368626 predicted 522
8 SASI_Rn02_00368627 predicted 2576
9 SASI_Rn02_00368628 predicted 2404
10 SASI_Rn02_00368629 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573413 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400246 predicted 309
2 SASI_Rn02_00400247 predicted 582
3 SASI_Rn02_00400248 predicted 617
4 SASI_Rn02_00400249 predicted 520
5 SASI_Rn02_00400250 predicted 676
6 SASI_Rn02_00400251 predicted 323
7 SASI_Rn02_00400252 predicted 453
8 SASI_Rn02_00400253 predicted 631
9 SASI_Rn02_00400254 predicted 436
10 SASI_Rn02_00400255 predicted 1999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081235 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296497 predicted 2335
2 SASI_Mm02_00296498 predicted 2473
3 SASI_Mm02_00296499 predicted 3165
4 SASI_Mm02_00296500 predicted 580
5 SASI_Mm02_00296501 predicted 2290
6 SASI_Mm02_00296502 predicted 3502
7 SASI_Mm02_00296503 predicted 353
8 SASI_Mm02_00296504 predicted 450
9 SASI_Mm02_00296505 predicted 345
10 SASI_Mm02_00296506 predicted 2558
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271156 predicted 2347
2 SASI_Mm01_00271157 predicted 2481
3 SASI_Mm01_00271158 predicted 3177
4 SASI_Mm01_00271159 predicted 591
5 SASI_Mm01_00271160 predicted 2298
6 SASI_Mm01_00271161 predicted 3630
7 SASI_Mm01_00271162 predicted 364
8 SASI_Mm01_00271163 predicted 452
9 SASI_Mm01_00271164 predicted 351
10 SASI_Mm01_00271165 predicted 2562
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901656 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217195 predicted 1457
2 SASI_Mm01_00217196 predicted 1589
3 SASI_Mm01_00217197 predicted 2286
4 SASI_Mm01_00217198 predicted 1410
5 SASI_Mm01_00217199 predicted 2625
6 SASI_Mm01_00217200 predicted 1406
7 SASI_Mm01_00217201 predicted 2739
8 SASI_Mm01_00217202 predicted 1673
9 SASI_Mm01_00217203 predicted 1845
10 SASI_Mm01_00217204 predicted 1668
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002430
MN1 MISSION shRNA Bacterial Glycerol Stock
meningioma (disrupted in balanced translocation) 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002430.2-5386s21c1
Sequence:CCGGTGCTTTGTTCACTGCTTATTACTCGAGTAATAAGCAGTGAACAAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002430.2-2163s21c1
Sequence:CCGGAGCACGCGCAATTCGAGTATCCTCGAGGATACTCGAATTGCGCGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002430.2-2388s21c1
Sequence:CCGGACAACGGCGCTCTGGATAATCCTCGAGGATTATCCAGAGCGCCGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002430.1-4877s1c1
Sequence:CCGGCTCCAACAGATTTGGGACATTCTCGAGAATGTCCCAAATCTGTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002430.1-2216s1c1
Sequence:CCGGACCCTTATTCCGAGCCTGTTTCTCGAGAAACAGGCTCGGAATAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002430.1-1007s1c1
Sequence:CCGGCCAGGGCGAGAGGAACTTTAACTCGAGTTAAAGTTCCTCTCGCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002430.1-4267s1c1
Sequence:CCGGTGGGCATCATGTCTAACTCTACTCGAGTAGAGTTAGACATGATGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002430.1-1130s1c1
Sequence:CCGGCCCGATCTTGGGCATGAACATCTCGAGATGTTCATGCCCAAGATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002430
MN1 MISSION shRNA shRNA Plasmid DNA
meningioma (disrupted in balanced translocation) 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002430.2-5386s21c1
Sequence:CCGGTGCTTTGTTCACTGCTTATTACTCGAGTAATAAGCAGTGAACAAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002430.2-2163s21c1
Sequence:CCGGAGCACGCGCAATTCGAGTATCCTCGAGGATACTCGAATTGCGCGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002430.2-2388s21c1
Sequence:CCGGACAACGGCGCTCTGGATAATCCTCGAGGATTATCCAGAGCGCCGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002430.1-4877s1c1
Sequence:CCGGCTCCAACAGATTTGGGACATTCTCGAGAATGTCCCAAATCTGTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002430.1-2216s1c1
Sequence:CCGGACCCTTATTCCGAGCCTGTTTCTCGAGAAACAGGCTCGGAATAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002430.1-1007s1c1
Sequence:CCGGCCAGGGCGAGAGGAACTTTAACTCGAGTTAAAGTTCCTCTCGCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002430.1-4267s1c1
Sequence:CCGGTGGGCATCATGTCTAACTCTACTCGAGTAGAGTTAGACATGATGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002430.1-1130s1c1
Sequence:CCGGCCCGATCTTGGGCATGAACATCTCGAGATGTTCATGCCCAAGATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002430
MN1 MISSION shRNA Lentiviral Transduction Particles
meningioma (disrupted in balanced translocation) 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002430.2-5386s21c1
Sequence:CCGGTGCTTTGTTCACTGCTTATTACTCGAGTAATAAGCAGTGAACAAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002430.2-2163s21c1
Sequence:CCGGAGCACGCGCAATTCGAGTATCCTCGAGGATACTCGAATTGCGCGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002430.2-2388s21c1
Sequence:CCGGACAACGGCGCTCTGGATAATCCTCGAGGATTATCCAGAGCGCCGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002430.1-4877s1c1
Sequence:CCGGCTCCAACAGATTTGGGACATTCTCGAGAATGTCCCAAATCTGTTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002430.1-2216s1c1
Sequence:CCGGACCCTTATTCCGAGCCTGTTTCTCGAGAAACAGGCTCGGAATAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002430.1-1007s1c1
Sequence:CCGGCCAGGGCGAGAGGAACTTTAACTCGAGTTAAAGTTCCTCTCGCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002430.1-4267s1c1
Sequence:CCGGTGGGCATCATGTCTAACTCTACTCGAGTAGAGTTAGACATGATGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002430.1-1130s1c1
Sequence:CCGGCCCGATCTTGGGCATGAACATCTCGAGATGTTCATGCCCAAGATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081235
MN1 MISSION shRNA Bacterial Glycerol Stock
meningioma (disrupted in balanced translocation) 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081235.1-83s21c1
Sequence:CCGGTGAGCATGAACGCCCACTTTACTCGAGTAAAGTGGGCGTTCATGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081235.1-4018s21c1
Sequence:CCGGTGGGTCTAGGTTGGTACTTTCCTCGAGGAAAGTACCAACCTAGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081235.1-2810s21c1
Sequence:CCGGCCGGGACCTTCTTCGACAAATCTCGAGATTTGTCGAAGAAGGTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081235.1-1214s21c1
Sequence:CCGGACCGGAGCATGCACCCATATTCTCGAGAATATGGGTGCATGCTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081235.1-3082s21c1
Sequence:CCGGGATGAGGTGAGCACAAGTTATCTCGAGATAACTTGTGCTCACCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081235
MN1 MISSION shRNA shRNA Plasmid DNA
meningioma (disrupted in balanced translocation) 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081235.1-83s21c1
Sequence:CCGGTGAGCATGAACGCCCACTTTACTCGAGTAAAGTGGGCGTTCATGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081235.1-4018s21c1
Sequence:CCGGTGGGTCTAGGTTGGTACTTTCCTCGAGGAAAGTACCAACCTAGACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081235.1-2810s21c1
Sequence:CCGGCCGGGACCTTCTTCGACAAATCTCGAGATTTGTCGAAGAAGGTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081235.1-1214s21c1
Sequence:CCGGACCGGAGCATGCACCCATATTCTCGAGAATATGGGTGCATGCTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081235.1-3082s21c1
Sequence:CCGGGATGAGGTGAGCACAAGTTATCTCGAGATAACTTGTGCTCACCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081235
MN1 MISSION shRNA Lentiviral Transduction Particles
meningioma (disrupted in balanced translocation) 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081235.1-83s21c1
Sequence:CCGGTGAGCATGAACGCCCACTTTACTCGAGTAAAGTGGGCGTTCATGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081235.1-4018s21c1
Sequence:CCGGTGGGTCTAGGTTGGTACTTTCCTCGAGGAAAGTACCAACCTAGACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081235.1-2810s21c1
Sequence:CCGGCCGGGACCTTCTTCGACAAATCTCGAGATTTGTCGAAGAAGGTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081235.1-1214s21c1
Sequence:CCGGACCGGAGCATGCACCCATATTCTCGAGAATATGGGTGCATGCTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081235.1-3082s21c1
Sequence:CCGGGATGAGGTGAGCACAAGTTATCTCGAGATAACTTGTGCTCACCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)