EMAIL THIS PAGE TO A FRIEND

MNAT1

MNAT CDK-activating kinase assembly factor 1

61 Gene Product Result for
Synonyms: CAP35 MAT1 RNF66 TFB3
UniProtKB ID: P51948, G3V1U8, Q15817, Q6ICQ7
Gene ID:
Human(4331) Summary: The protein encoded by this gene, along with cyclin H and CDK7, forms the CDK-activating kinase (CAK) enzymatic complex. This complex activates several cyclin-associated kinases and can also associate with TFIIH to activate transcription by RNA polymerase II. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(17420) menage a trois 1
Rat(266713) MNAT CDK-activating kinase assembly factor 1
Zebrafish(450080) menage a trois homolog 1
cow(534176) menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)
domestic cat(101082665) menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)
dog(480346) menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)
chicken(423521) menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)
domestic guinea pig(100719238) menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)
naked mole-rat(101718839) menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)
sheep(101104405) menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008612 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008612 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008612 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002431 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044421 MISSION® esiRNA esiRNA human MNAT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002431 Rosetta Predictions human pricing
NM_153472 Rosetta Predictions rat pricing
NM_008612 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242408 predicted 274
2 SASI_Hs01_00242409 predicted 874
3 SASI_Hs01_00242410 predicted 267
4 SASI_Hs01_00242412 predicted 191
5 SASI_Hs01_00242413 predicted 433
6 SASI_Hs01_00242414 predicted 812
7 SASI_Hs01_00242415 predicted 291
8 SASI_Hs01_00242416 predicted 1033
9 SASI_Hs01_00242417 predicted 868
10 SASI_Hs02_00333829 predicted 204
11 SASI_Hs01_00242411 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153472 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069308 predicted 849
2 SASI_Rn01_00069309 predicted 734
3 SASI_Rn01_00069310 predicted 766
4 SASI_Rn02_00268986 predicted 700
5 SASI_Rn01_00069311 predicted 908
6 SASI_Rn01_00069312 predicted 896
7 SASI_Rn01_00069313 predicted 845
8 SASI_Rn01_00069314 predicted 940
9 SASI_Rn01_00069315 predicted 933
10 SASI_Rn01_00069316 predicted 653
11 SASI_Rn01_00069307 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008612 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182250 predicted 909
2 SASI_Mm01_00182251 predicted 810
3 SASI_Mm01_00182252 predicted 960
4 SASI_Mm01_00182253 predicted 281
5 SASI_Mm01_00182254 predicted 219
6 SASI_Mm01_00182255 predicted 908
7 SASI_Mm01_00182257 predicted 954
8 SASI_Mm01_00182259 predicted 383
9 SASI_Mm02_00314285 predicted 642
10 SASI_Mm02_00314286 predicted 761
11 SASI_Mm01_00182256 predicted 308
12 SASI_Mm01_00182258 predicted 141
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008612
MNAT1 MISSION shRNA Bacterial Glycerol Stock
MNAT CDK-activating kinase assembly factor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008612.1-253s1c1
Sequence:CCGGGTGTGGACTTACTGTTTGTAACTCGAGTTACAAACAGTAAGTCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008612.1-845s1c1
Sequence:CCGGACAGATTTCATTAGCACCAATCTCGAGATTGGTGCTAATGAAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008612.1-302s1c1
Sequence:CCGGGACTCCACTGAGAAAGAGCAACTCGAGTTGCTCTTTCTCAGTGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008612.1-354s1c1
Sequence:CCGGGTTGATAAGGAGGTTGAAATTCTCGAGAATTTCAACCTCCTTATCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008612.1-748s1c1
Sequence:CCGGCGCAGCATAAAGACAGATCGACTCGAGTCGATCTGTCTTTATGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008612
MNAT1 MISSION shRNA shRNA Plasmid DNA
MNAT CDK-activating kinase assembly factor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008612.1-253s1c1
Sequence:CCGGGTGTGGACTTACTGTTTGTAACTCGAGTTACAAACAGTAAGTCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008612.1-845s1c1
Sequence:CCGGACAGATTTCATTAGCACCAATCTCGAGATTGGTGCTAATGAAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008612.1-302s1c1
Sequence:CCGGGACTCCACTGAGAAAGAGCAACTCGAGTTGCTCTTTCTCAGTGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008612.1-354s1c1
Sequence:CCGGGTTGATAAGGAGGTTGAAATTCTCGAGAATTTCAACCTCCTTATCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008612.1-748s1c1
Sequence:CCGGCGCAGCATAAAGACAGATCGACTCGAGTCGATCTGTCTTTATGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008612
MNAT1 MISSION shRNA Lentiviral Transduction Particles
MNAT CDK-activating kinase assembly factor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008612.1-253s1c1
Sequence:CCGGGTGTGGACTTACTGTTTGTAACTCGAGTTACAAACAGTAAGTCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008612.1-845s1c1
Sequence:CCGGACAGATTTCATTAGCACCAATCTCGAGATTGGTGCTAATGAAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008612.1-302s1c1
Sequence:CCGGGACTCCACTGAGAAAGAGCAACTCGAGTTGCTCTTTCTCAGTGGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008612.1-354s1c1
Sequence:CCGGGTTGATAAGGAGGTTGAAATTCTCGAGAATTTCAACCTCCTTATCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008612.1-748s1c1
Sequence:CCGGCGCAGCATAAAGACAGATCGACTCGAGTCGATCTGTCTTTATGCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002431
VALIDATED
MNAT1 MISSION shRNA Bacterial Glycerol Stock
MNAT CDK-activating kinase assembly factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002431.1-302s1c1
Sequence:CCGGCCTAGTCTAAGAGAATACAATCTCGAGATTGTATTCTCTTAGACTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002431.1-122s1c1
Sequence:CCGGCTCTGTGAAAGTTGTGTAGATCTCGAGATCTACACAACTTTCACAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_002431.1-781s1c1
Sequence:CCGGGCCACTGCAGATAGAGACATACTCGAGTATGTCTCTATCTGCAGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002431.1-371s1c1
Sequence:CCGGGTGGATTTGGACAACACCAAACTCGAGTTTGGTGTTGTCCAAATCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002431.1-891s1c1
Sequence:CCGGGCTATACTTCTTCTCTTGCTTCTCGAGAAGCAAGAGAAGAAGTATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002431.2-858s21c1
Sequence:CCGGGCCACTGCAGATAGAGACATACTCGAGTATGTCTCTATCTGCAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002431.2-199s21c1
Sequence:CCGGCTCTGTGAAAGTTGTGTAGATCTCGAGATCTACACAACTTTCACAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002431.2-379s21c1
Sequence:CCGGCCTAGTCTAAGAGAATACAATCTCGAGATTGTATTCTCTTAGACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002431.2-448s21c1
Sequence:CCGGGTGGATTTGGACAACACCAAACTCGAGTTTGGTGTTGTCCAAATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002431.2-968s21c1
Sequence:CCGGGCTATACTTCTTCTCTTGCTTCTCGAGAAGCAAGAGAAGAAGTATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002431
VALIDATED
MNAT1 MISSION shRNA shRNA Plasmid DNA
MNAT CDK-activating kinase assembly factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002431.1-302s1c1
Sequence:CCGGCCTAGTCTAAGAGAATACAATCTCGAGATTGTATTCTCTTAGACTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002431.1-122s1c1
Sequence:CCGGCTCTGTGAAAGTTGTGTAGATCTCGAGATCTACACAACTTTCACAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_002431.1-781s1c1
Sequence:CCGGGCCACTGCAGATAGAGACATACTCGAGTATGTCTCTATCTGCAGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002431.1-371s1c1
Sequence:CCGGGTGGATTTGGACAACACCAAACTCGAGTTTGGTGTTGTCCAAATCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002431.1-891s1c1
Sequence:CCGGGCTATACTTCTTCTCTTGCTTCTCGAGAAGCAAGAGAAGAAGTATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002431.2-858s21c1
Sequence:CCGGGCCACTGCAGATAGAGACATACTCGAGTATGTCTCTATCTGCAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002431.2-199s21c1
Sequence:CCGGCTCTGTGAAAGTTGTGTAGATCTCGAGATCTACACAACTTTCACAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002431.2-379s21c1
Sequence:CCGGCCTAGTCTAAGAGAATACAATCTCGAGATTGTATTCTCTTAGACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002431.2-448s21c1
Sequence:CCGGGTGGATTTGGACAACACCAAACTCGAGTTTGGTGTTGTCCAAATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002431.2-968s21c1
Sequence:CCGGGCTATACTTCTTCTCTTGCTTCTCGAGAAGCAAGAGAAGAAGTATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002431
VALIDATED
MNAT1 MISSION shRNA Lentiviral Transduction Particles
MNAT CDK-activating kinase assembly factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002431.1-302s1c1
Sequence:CCGGCCTAGTCTAAGAGAATACAATCTCGAGATTGTATTCTCTTAGACTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002431.1-122s1c1
Sequence:CCGGCTCTGTGAAAGTTGTGTAGATCTCGAGATCTACACAACTTTCACAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_002431.1-781s1c1
Sequence:CCGGGCCACTGCAGATAGAGACATACTCGAGTATGTCTCTATCTGCAGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002431.1-371s1c1
Sequence:CCGGGTGGATTTGGACAACACCAAACTCGAGTTTGGTGTTGTCCAAATCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002431.1-891s1c1
Sequence:CCGGGCTATACTTCTTCTCTTGCTTCTCGAGAAGCAAGAGAAGAAGTATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002431.2-858s21c1
Sequence:CCGGGCCACTGCAGATAGAGACATACTCGAGTATGTCTCTATCTGCAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002431.2-199s21c1
Sequence:CCGGCTCTGTGAAAGTTGTGTAGATCTCGAGATCTACACAACTTTCACAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002431.2-379s21c1
Sequence:CCGGCCTAGTCTAAGAGAATACAATCTCGAGATTGTATTCTCTTAGACTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002431.2-448s21c1
Sequence:CCGGGTGGATTTGGACAACACCAAACTCGAGTTTGGTGTTGTCCAAATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002431.2-968s21c1
Sequence:CCGGGCTATACTTCTTCTCTTGCTTCTCGAGAAGCAAGAGAAGAAGTATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)