EMAIL THIS PAGE TO A FRIEND

MNDA

myeloid cell nuclear differentiation antigen

58 Gene Product Result for
Synonyms: PYHIN3
UniProtKB ID: P41218
Gene ID:
Human(4332) Summary: The myeloid cell nuclear differentiation antigen (MNDA) is detected only in nuclei of cells of the granulocyte-monocyte lineage. A 200-amino acid region of human MNDA is strikingly similar to a region in the proteins encoded by a family of interferon-inducible mouse genes, designated Ifi-201, Ifi-202, and Ifi-203, that are not regulated in a cell- or tissue-specific fashion. The 1.8-kb MNDA mRNA, which contains an interferon-stimulated response element in the 5-prime untranslated region, was significantly upregulated in human monocytes exposed to interferon alpha. MNDA is located within 2,200 kb of FCER1A, APCS, CRP, and SPTA1. In its pattern of expression and/or regulation, MNDA resembles IFI16, suggesting that these genes participate in blood cell-specific responses to interferons. [provided by RefSeq, Jul 2008]
Mouse(381308) myeloid cell nuclear differentiation antigen
Rat(304988) myeloid cell nuclear differentiation antigen
dog(488622) myeloid cell nuclear differentiation antigen
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002432 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033450 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033450 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033450 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002432 Rosetta Predictions human pricing
NM_001012029 Rosetta Predictions rat pricing
XM_573516 Rosetta Predictions rat pricing
NM_001033450 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333830 predicted 753
2 SASI_Hs01_00033498 predicted 943
3 SASI_Hs01_00033499 predicted 1113
4 SASI_Hs02_00333831 predicted 1392
5 SASI_Hs01_00033500 predicted 1005
6 SASI_Hs01_00033501 predicted 1004
7 SASI_Hs01_00033502 predicted 1184
8 SASI_Hs01_00033503 predicted 1318
9 SASI_Hs01_00033504 predicted 1146
10 SASI_Hs02_00333832 predicted 1089
11 SASI_Hs01_00033496 predicted 1288
12 SASI_Hs01_00033497 predicted 1208
13 SASI_Hs01_00033505 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012029 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056524 predicted 413
2 SASI_Rn01_00056525 predicted 795
3 SASI_Rn01_00056526 predicted 351
4 SASI_Rn01_00056527 predicted 1332
5 SASI_Rn01_00056528 predicted 1266
6 SASI_Rn01_00056529 predicted 317
7 SASI_Rn01_00056530 predicted 1505
8 SASI_Rn01_00056532 predicted 256
9 SASI_Rn01_00056533 predicted 1351
10 SASI_Rn02_00200115 predicted 1515
11 SASI_Rn01_00056531 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573516 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00153938 predicted 443
2 SASI_Rn01_00153939 predicted 1430
3 SASI_Rn01_00153940 predicted 1364
4 SASI_Rn01_00153941 predicted 1359
5 SASI_Rn01_00153942 predicted 417
6 SASI_Rn01_00153943 predicted 1537
7 SASI_Rn01_00153944 predicted 414
8 SASI_Rn01_00153945 predicted 1395
9 SASI_Rn01_00153946 predicted 1366
10 SASI_Rn01_00153947 predicted 1364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198254 predicted 249
2 SASI_Mm01_00198255 predicted 213
3 SASI_Mm01_00198256 predicted 213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002432
MNDA MISSION shRNA Bacterial Glycerol Stock
myeloid cell nuclear differentiation antigen
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002432.1-1268s1c1
Sequence:CCGGGCACAATATCAAGTGTGAGAACTCGAGTTCTCACACTTGATATTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002432.1-550s1c1
Sequence:CCGGCCGCAAGAAACAAACTGACATCTCGAGATGTCAGTTTGTTTCTTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002432.1-431s1c1
Sequence:CCGGCCTTGTTAACAATCTTCGAAACTCGAGTTTCGAAGATTGTTAACAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002432.1-1085s1c1
Sequence:CCGGCCCAAACAGAATTATCGAAATCTCGAGATTTCGATAATTCTGTTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002432.1-1156s21c1
Sequence:CCGGCAATGGTGTATGGGTTGTTTACTCGAGTAAACAACCCATACACCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002432.1-289s1c1
Sequence:CCGGCCTATGATTTAGGACTAACTACTCGAGTAGTTAGTCCTAAATCATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002432.1-1118s21c1
Sequence:CCGGTCCCAAGATCAGTCAACTTTACTCGAGTAAAGTTGACTGATCTTGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002432
MNDA MISSION shRNA shRNA Plasmid DNA
myeloid cell nuclear differentiation antigen
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002432.1-1268s1c1
Sequence:CCGGGCACAATATCAAGTGTGAGAACTCGAGTTCTCACACTTGATATTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002432.1-550s1c1
Sequence:CCGGCCGCAAGAAACAAACTGACATCTCGAGATGTCAGTTTGTTTCTTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002432.1-431s1c1
Sequence:CCGGCCTTGTTAACAATCTTCGAAACTCGAGTTTCGAAGATTGTTAACAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002432.1-1085s1c1
Sequence:CCGGCCCAAACAGAATTATCGAAATCTCGAGATTTCGATAATTCTGTTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002432.1-1156s21c1
Sequence:CCGGCAATGGTGTATGGGTTGTTTACTCGAGTAAACAACCCATACACCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002432.1-289s1c1
Sequence:CCGGCCTATGATTTAGGACTAACTACTCGAGTAGTTAGTCCTAAATCATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002432.1-1118s21c1
Sequence:CCGGTCCCAAGATCAGTCAACTTTACTCGAGTAAAGTTGACTGATCTTGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002432
MNDA MISSION shRNA Lentiviral Transduction Particles
myeloid cell nuclear differentiation antigen
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002432.1-1268s1c1
Sequence:CCGGGCACAATATCAAGTGTGAGAACTCGAGTTCTCACACTTGATATTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002432.1-550s1c1
Sequence:CCGGCCGCAAGAAACAAACTGACATCTCGAGATGTCAGTTTGTTTCTTGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002432.1-431s1c1
Sequence:CCGGCCTTGTTAACAATCTTCGAAACTCGAGTTTCGAAGATTGTTAACAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002432.1-1085s1c1
Sequence:CCGGCCCAAACAGAATTATCGAAATCTCGAGATTTCGATAATTCTGTTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002432.1-1156s21c1
Sequence:CCGGCAATGGTGTATGGGTTGTTTACTCGAGTAAACAACCCATACACCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002432.1-289s1c1
Sequence:CCGGCCTATGATTTAGGACTAACTACTCGAGTAGTTAGTCCTAAATCATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002432.1-1118s21c1
Sequence:CCGGTCCCAAGATCAGTCAACTTTACTCGAGTAAAGTTGACTGATCTTGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033450
VALIDATED
MNDA MISSION shRNA Bacterial Glycerol Stock
myeloid cell nuclear differentiation antigen
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033450.3-211s21c1
Sequence:CCGGTTGCTGGCCAGAGATTTAAATCTCGAGATTTAAATCTCTGGCCAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033450.3-1103s21c1
Sequence:GTACCGGGTCCTAAGATCTGTGATATTCCTCGAGGAATATCACAGATCTTAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033450.3-719s21c1
Sequence:CCGGCTTCGGCTTCATCTAACATTCCTCGAGGAATGTTAGATGAAGCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033450.3-164s21c1
Sequence:CCGGGAGGACTTGAATGTATCAATACTCGAGTATTGATACATTCAAGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033450.3-1470s21c1
Sequence:CCGGATAGAAATGTCACCTCTAAATCTCGAGATTTAGAGGTGACATTTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033450.3-973s21c1
Sequence:CCGGTTTATCACCATATCCAATTACCTCGAGGTAATTGGATATGGTGATAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033450.3-1072s21c1
Sequence:CCGGCCCAACTGTATTACCAGAAATCTCGAGATTTCTGGTAATACAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033450.3-858s21c1
Sequence:CCGGATCACCAGAACATGAAGTAAACTCGAGTTTACTTCATGTTCTGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033450.3-1443s21c1
Sequence:CCGGAGTTGGAATTAAGGTAGAGATCTCGAGATCTCTACCTTAATTCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033450.3-900s21c1
Sequence:CCGGGGCTACAGTGAGCCAGTATTTCTCGAGAAATACTGGCTCACTGTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033450
VALIDATED
MNDA MISSION shRNA shRNA Plasmid DNA
myeloid cell nuclear differentiation antigen
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033450.3-211s21c1
Sequence:CCGGTTGCTGGCCAGAGATTTAAATCTCGAGATTTAAATCTCTGGCCAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033450.3-1103s21c1
Sequence:GTACCGGGTCCTAAGATCTGTGATATTCCTCGAGGAATATCACAGATCTTAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033450.3-719s21c1
Sequence:CCGGCTTCGGCTTCATCTAACATTCCTCGAGGAATGTTAGATGAAGCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033450.3-164s21c1
Sequence:CCGGGAGGACTTGAATGTATCAATACTCGAGTATTGATACATTCAAGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033450.3-1470s21c1
Sequence:CCGGATAGAAATGTCACCTCTAAATCTCGAGATTTAGAGGTGACATTTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033450.3-973s21c1
Sequence:CCGGTTTATCACCATATCCAATTACCTCGAGGTAATTGGATATGGTGATAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033450.3-1072s21c1
Sequence:CCGGCCCAACTGTATTACCAGAAATCTCGAGATTTCTGGTAATACAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033450.3-858s21c1
Sequence:CCGGATCACCAGAACATGAAGTAAACTCGAGTTTACTTCATGTTCTGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033450.3-1443s21c1
Sequence:CCGGAGTTGGAATTAAGGTAGAGATCTCGAGATCTCTACCTTAATTCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033450.3-900s21c1
Sequence:CCGGGGCTACAGTGAGCCAGTATTTCTCGAGAAATACTGGCTCACTGTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033450
VALIDATED
MNDA MISSION shRNA Lentiviral Transduction Particles
myeloid cell nuclear differentiation antigen
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033450.3-211s21c1
Sequence:CCGGTTGCTGGCCAGAGATTTAAATCTCGAGATTTAAATCTCTGGCCAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033450.3-1103s21c1
Sequence:GTACCGGGTCCTAAGATCTGTGATATTCCTCGAGGAATATCACAGATCTTAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033450.3-719s21c1
Sequence:CCGGCTTCGGCTTCATCTAACATTCCTCGAGGAATGTTAGATGAAGCCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033450.3-164s21c1
Sequence:CCGGGAGGACTTGAATGTATCAATACTCGAGTATTGATACATTCAAGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033450.3-1470s21c1
Sequence:CCGGATAGAAATGTCACCTCTAAATCTCGAGATTTAGAGGTGACATTTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033450.3-973s21c1
Sequence:CCGGTTTATCACCATATCCAATTACCTCGAGGTAATTGGATATGGTGATAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033450.3-1072s21c1
Sequence:CCGGCCCAACTGTATTACCAGAAATCTCGAGATTTCTGGTAATACAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033450.3-858s21c1
Sequence:CCGGATCACCAGAACATGAAGTAAACTCGAGTTTACTTCATGTTCTGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033450.3-1443s21c1
Sequence:CCGGAGTTGGAATTAAGGTAGAGATCTCGAGATCTCTACCTTAATTCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033450.3-900s21c1
Sequence:CCGGGGCTACAGTGAGCCAGTATTTCTCGAGAAATACTGGCTCACTGTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)