EMAIL THIS PAGE TO A FRIEND

MNF1

mitochondrial nucleoid factor 1

49 Gene Product Result for
Synonyms: C6orf125 Cbp6 M19 bA6B20.2
UniProtKB ID: Q9BRT2, B2R4I0
Gene ID:
Human(84300) Summary: This gene encodes a nucleoid protein localized to the mitochondria inner membrane. The encoded protein affects regulation of insulin secretion, mitochondrial ATP production, and myogenesis through modulation of mitochondrial respiratory chain activity. [provided by RefSeq, Oct 2012]
Mouse(67267) mitochondrial nucleoid factor 1
Rat(361805) mitochondrial nucleoid factor 1
sheep(101118647) mitochondrial nucleoid factor 1
domestic guinea pig(100728900) mitochondrial nucleoid factor 1
naked mole-rat(101706352) mitochondrial nucleoid factor 1
cow(100607974) mitochondrial nucleoid factor 1
dog(100683221) mitochondrial nucleoid factor 1
domestic cat(101093686) mitochondrial nucleoid factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026063 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026063 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026063 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032340 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032340 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032340 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032340 Rosetta Predictions human pricing
NM_001108528 Rosetta Predictions rat pricing
NM_026063 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140517 predicted 209
2 SASI_Hs01_00140518 predicted 284
3 SASI_Hs01_00140519 predicted 217
4 SASI_Hs01_00140520 predicted 268
5 SASI_Hs01_00140521 predicted 208
6 SASI_Hs01_00140522 predicted 217
7 SASI_Hs01_00140523 predicted 286
8 SASI_Hs01_00140524 predicted 285
9 SASI_Hs01_00140525 predicted 213
10 SASI_Hs01_00140526 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239529 predicted 210
2 SASI_Rn02_00239530 predicted 219
3 SASI_Rn02_00239531 predicted 220
4 SASI_Rn02_00239532 predicted 226
5 SASI_Rn02_00239533 predicted 206
6 SASI_Rn02_00239534 predicted 216
7 SASI_Rn02_00239535 predicted 223
8 SASI_Rn02_00239536 predicted 272
9 SASI_Rn02_00239537 predicted 215
10 SASI_Rn02_00239538 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026063 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102196 predicted 201
2 SASI_Mm01_00102198 predicted 244
3 SASI_Mm01_00102199 predicted 241
4 SASI_Mm01_00102200 predicted 192
5 SASI_Mm01_00102201 predicted 206
6 SASI_Mm01_00102202 predicted 195
7 SASI_Mm01_00102203 predicted 285
8 SASI_Mm02_00329603 predicted 161
9 SASI_Mm02_00329604 predicted 187
10 SASI_Mm01_00102194 predicted 195
11 SASI_Mm01_00102195 predicted 206
12 SASI_Mm01_00102197 predicted 198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026063
VALIDATED
MNF1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial nucleoid factor 1
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026063.2-323s21c1
Sequence:CCGGGAATAAGAGCATGTGGAAGAACTCGAGTTCTTCCACATGCTCTTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026063.1-45s1c1
Sequence:CCGGCCTTAAGCTCTGTGAGGAATGCTCGAGCATTCCTCACAGAGCTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026063.1-296s1c1
Sequence:CCGGCCACAGACACTTTGGAAGAGTCTCGAGACTCTTCCAAAGTGTCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026063.1-297s1c1
Sequence:CCGGCACAGACACTTTGGAAGAGTTCTCGAGAACTCTTCCAAAGTGTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026063.1-327s1c1
Sequence:CCGGGAATAAGAGCATGTGGAAGAACTCGAGTTCTTCCACATGCTCTTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026063.1-310s1c1
Sequence:CCGGGAAGAGTTCCAAGAGATGAATCTCGAGATTCATCTCTTGGAACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026063.1-288s1c1
Sequence:CCGGGATCCTGTCCACAGACACTTTCTCGAGAAAGTGTCTGTGGACAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026063.2-203s21c1
Sequence:CCGGGCATTCAAACTACTACAAGCACTCGAGTGCTTGTAGTAGTTTGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026063.2-306s21c1
Sequence:CCGGGAAGAGTTCCAAGAGATGAATCTCGAGATTCATCTCTTGGAACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026063.2-262s21c1
Sequence:CCGGTGTCCGTGGAAGAGTACAAGCCTCGAGGCTTGTACTCTTCCACGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026063.2-175s21c1
Sequence:CCGGATCAGATGTACGAGAGCTTAGCTCGAGCTAAGCTCTCGTACATCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026063.1-318s1c1
Sequence:CCGGCCAAGAGATGAATAAGAGCATCTCGAGATGCTCTTATTCATCTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026063.1-207s1c1
Sequence:CCGGGCATTCAAACTACTACAAGCACTCGAGTGCTTGTAGTAGTTTGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026063.1-145s1c1
Sequence:CCGGGAGAACACCCAGATTGCAGAACTCGAGTTCTGCAATCTGGGTGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026063.1-194s1c1
Sequence:CCGGGCTTAGCACGACTGCATTCAACTCGAGTTGAATGCAGTCGTGCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026063
VALIDATED
MNF1 MISSION shRNA shRNA Plasmid DNA
mitochondrial nucleoid factor 1
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026063.2-323s21c1
Sequence:CCGGGAATAAGAGCATGTGGAAGAACTCGAGTTCTTCCACATGCTCTTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026063.1-45s1c1
Sequence:CCGGCCTTAAGCTCTGTGAGGAATGCTCGAGCATTCCTCACAGAGCTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026063.1-296s1c1
Sequence:CCGGCCACAGACACTTTGGAAGAGTCTCGAGACTCTTCCAAAGTGTCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026063.1-297s1c1
Sequence:CCGGCACAGACACTTTGGAAGAGTTCTCGAGAACTCTTCCAAAGTGTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026063.1-327s1c1
Sequence:CCGGGAATAAGAGCATGTGGAAGAACTCGAGTTCTTCCACATGCTCTTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026063.1-310s1c1
Sequence:CCGGGAAGAGTTCCAAGAGATGAATCTCGAGATTCATCTCTTGGAACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026063.1-288s1c1
Sequence:CCGGGATCCTGTCCACAGACACTTTCTCGAGAAAGTGTCTGTGGACAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026063.2-203s21c1
Sequence:CCGGGCATTCAAACTACTACAAGCACTCGAGTGCTTGTAGTAGTTTGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026063.2-306s21c1
Sequence:CCGGGAAGAGTTCCAAGAGATGAATCTCGAGATTCATCTCTTGGAACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026063.2-262s21c1
Sequence:CCGGTGTCCGTGGAAGAGTACAAGCCTCGAGGCTTGTACTCTTCCACGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026063.2-175s21c1
Sequence:CCGGATCAGATGTACGAGAGCTTAGCTCGAGCTAAGCTCTCGTACATCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026063.1-318s1c1
Sequence:CCGGCCAAGAGATGAATAAGAGCATCTCGAGATGCTCTTATTCATCTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026063.1-207s1c1
Sequence:CCGGGCATTCAAACTACTACAAGCACTCGAGTGCTTGTAGTAGTTTGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026063.1-145s1c1
Sequence:CCGGGAGAACACCCAGATTGCAGAACTCGAGTTCTGCAATCTGGGTGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026063.1-194s1c1
Sequence:CCGGGCTTAGCACGACTGCATTCAACTCGAGTTGAATGCAGTCGTGCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026063
VALIDATED
MNF1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial nucleoid factor 1
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026063.2-323s21c1
Sequence:CCGGGAATAAGAGCATGTGGAAGAACTCGAGTTCTTCCACATGCTCTTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026063.1-45s1c1
Sequence:CCGGCCTTAAGCTCTGTGAGGAATGCTCGAGCATTCCTCACAGAGCTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026063.1-296s1c1
Sequence:CCGGCCACAGACACTTTGGAAGAGTCTCGAGACTCTTCCAAAGTGTCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026063.1-297s1c1
Sequence:CCGGCACAGACACTTTGGAAGAGTTCTCGAGAACTCTTCCAAAGTGTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026063.1-327s1c1
Sequence:CCGGGAATAAGAGCATGTGGAAGAACTCGAGTTCTTCCACATGCTCTTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026063.1-310s1c1
Sequence:CCGGGAAGAGTTCCAAGAGATGAATCTCGAGATTCATCTCTTGGAACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026063.1-288s1c1
Sequence:CCGGGATCCTGTCCACAGACACTTTCTCGAGAAAGTGTCTGTGGACAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026063.2-203s21c1
Sequence:CCGGGCATTCAAACTACTACAAGCACTCGAGTGCTTGTAGTAGTTTGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026063.2-306s21c1
Sequence:CCGGGAAGAGTTCCAAGAGATGAATCTCGAGATTCATCTCTTGGAACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026063.2-262s21c1
Sequence:CCGGTGTCCGTGGAAGAGTACAAGCCTCGAGGCTTGTACTCTTCCACGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026063.2-175s21c1
Sequence:CCGGATCAGATGTACGAGAGCTTAGCTCGAGCTAAGCTCTCGTACATCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026063.1-318s1c1
Sequence:CCGGCCAAGAGATGAATAAGAGCATCTCGAGATGCTCTTATTCATCTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026063.1-207s1c1
Sequence:CCGGGCATTCAAACTACTACAAGCACTCGAGTGCTTGTAGTAGTTTGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026063.1-145s1c1
Sequence:CCGGGAGAACACCCAGATTGCAGAACTCGAGTTCTGCAATCTGGGTGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026063.1-194s1c1
Sequence:CCGGGCTTAGCACGACTGCATTCAACTCGAGTTGAATGCAGTCGTGCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032340
VALIDATED
MNF1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial nucleoid factor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-293s1c1
Sequence:CCGGGTTGGAAGAGTACAAGCTGATCTCGAGATCAGCTTGTACTCTTCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-235s1c1
Sequence:CCGGCAAACTACTACAAACACAAGTCTCGAGACTTGTGTTTGTAGTAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-201s1c1
Sequence:CCGGGATCAGATGTACGAGAGCTTACTCGAGTAAGCTCTCGTACATCTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-322s1c1
Sequence:CCGGCAGACACCTTGGAAGAGCTTACTCGAGTAAGCTCTTCCAAGGTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-328s1c1
Sequence:CCGGCCTTGGAAGAGCTTAAGGAAACTCGAGTTTCCTTAAGCTCTTCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-333s1c1
Sequence:CCGGGAAGAGCTTAAGGAAATAGATCTCGAGATCTATTTCCTTAAGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-351s1c1
Sequence:CCGGGATAAAGGCATGTGGAAGAAACTCGAGTTTCTTCCACATGCCTTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-362s1c1
Sequence:CCGGGTGGAAGAAACTGCAGGAGAACTCGAGTTCTCCTGCAGTTTCTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-230s1c1
Sequence:CCGGCCATTCAAACTACTACAAACACTCGAGTGTTTGTAGTAGTTTGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032340
VALIDATED
MNF1 MISSION shRNA shRNA Plasmid DNA
mitochondrial nucleoid factor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-293s1c1
Sequence:CCGGGTTGGAAGAGTACAAGCTGATCTCGAGATCAGCTTGTACTCTTCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-235s1c1
Sequence:CCGGCAAACTACTACAAACACAAGTCTCGAGACTTGTGTTTGTAGTAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-201s1c1
Sequence:CCGGGATCAGATGTACGAGAGCTTACTCGAGTAAGCTCTCGTACATCTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-322s1c1
Sequence:CCGGCAGACACCTTGGAAGAGCTTACTCGAGTAAGCTCTTCCAAGGTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-328s1c1
Sequence:CCGGCCTTGGAAGAGCTTAAGGAAACTCGAGTTTCCTTAAGCTCTTCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-333s1c1
Sequence:CCGGGAAGAGCTTAAGGAAATAGATCTCGAGATCTATTTCCTTAAGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-351s1c1
Sequence:CCGGGATAAAGGCATGTGGAAGAAACTCGAGTTTCTTCCACATGCCTTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-362s1c1
Sequence:CCGGGTGGAAGAAACTGCAGGAGAACTCGAGTTCTCCTGCAGTTTCTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-230s1c1
Sequence:CCGGCCATTCAAACTACTACAAACACTCGAGTGTTTGTAGTAGTTTGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032340
VALIDATED
MNF1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial nucleoid factor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-293s1c1
Sequence:CCGGGTTGGAAGAGTACAAGCTGATCTCGAGATCAGCTTGTACTCTTCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-235s1c1
Sequence:CCGGCAAACTACTACAAACACAAGTCTCGAGACTTGTGTTTGTAGTAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-201s1c1
Sequence:CCGGGATCAGATGTACGAGAGCTTACTCGAGTAAGCTCTCGTACATCTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-322s1c1
Sequence:CCGGCAGACACCTTGGAAGAGCTTACTCGAGTAAGCTCTTCCAAGGTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-328s1c1
Sequence:CCGGCCTTGGAAGAGCTTAAGGAAACTCGAGTTTCCTTAAGCTCTTCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-333s1c1
Sequence:CCGGGAAGAGCTTAAGGAAATAGATCTCGAGATCTATTTCCTTAAGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-351s1c1
Sequence:CCGGGATAAAGGCATGTGGAAGAAACTCGAGTTTCTTCCACATGCCTTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-362s1c1
Sequence:CCGGGTGGAAGAAACTGCAGGAGAACTCGAGTTCTCCTGCAGTTTCTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032340.1-230s1c1
Sequence:CCGGCCATTCAAACTACTACAAACACTCGAGTGTTTGTAGTAGTTTGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)