EMAIL THIS PAGE TO A FRIEND

MNS1

meiosis-specific nuclear structural 1

57 Gene Product Result for
Synonyms: SPATA40
UniProtKB ID: Q8NEH6, Q8IYT6, Q9NUP4
Gene ID:
Human(55329) Summary: This gene encodes a protein highly similar to the mouse meiosis-specific nuclear structural 1 protein. The mouse protein was shown to be expressed at the pachytene stage during spermatogenesis and may function as a nuclear skeletal protein to regulate nuclear morphology during meiosis. [provided by RefSeq, Oct 2008]
Mouse(17427) meiosis-specific nuclear structural protein 1
Rat(363093) meiosis-specific nuclear structural 1
Zebrafish(573382) meiosis-specific nuclear structural 1
dog(478314) meiosis-specific nuclear structural 1
domestic cat(101084455) meiosis-specific nuclear structural 1
cow(532884) meiosis-specific nuclear structural 1
Thale Cress(841584) mannosyl-oligosaccharide 1,2-alpha-mannosidase MNS1
sheep(101120667) meiosis-specific nuclear structural 1
naked mole-rat(101705439) meiosis-specific nuclear structural 1
domestic guinea pig(100716216) meiosis-specific nuclear structural 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018365 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008613 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008613 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008613 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018365 Rosetta Predictions human pricing
NM_001007752 Rosetta Predictions rat pricing
NM_008613 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351834 predicted 278
2 SASI_Hs01_00192284 predicted 1544
3 SASI_Hs02_00351835 predicted 510
4 SASI_Hs01_00192285 predicted 261
5 SASI_Hs01_00192286 predicted 1547
6 SASI_Hs01_00192287 predicted 1472
7 SASI_Hs01_00192288 predicted 1531
8 SASI_Hs01_00192289 predicted 1422
9 SASI_Hs01_00192290 predicted 1521
10 SASI_Hs01_00192291 predicted 1513
11 SASI_Hs01_00192292 predicted 527
12 SASI_Hs01_00192293 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069327 predicted 1441
2 SASI_Rn01_00069328 predicted 562
3 SASI_Rn02_00198945 predicted 1410
4 SASI_Rn01_00069330 predicted 241
5 SASI_Rn01_00069331 predicted 848
6 SASI_Rn01_00069332 predicted 789
7 SASI_Rn02_00198946 predicted 1488
8 SASI_Rn01_00069334 predicted 1189
9 SASI_Rn01_00069335 predicted 767
10 SASI_Rn02_00198947 predicted 468
11 SASI_Rn01_00069329 predicted 479
12 SASI_Rn01_00069333 predicted 509
13 SASI_Rn01_00069336 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008613 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118975 predicted 1031
2 SASI_Mm01_00118976 predicted 523
3 SASI_Mm01_00118977 predicted 468
4 SASI_Mm01_00118978 predicted 380
5 SASI_Mm01_00118979 predicted 1230
6 SASI_Mm01_00118980 predicted 287
7 SASI_Mm01_00118981 predicted 242
8 SASI_Mm01_00118982 predicted 928
9 SASI_Mm01_00118983 predicted 1258
10 SASI_Mm02_00314287 predicted 286
11 SASI_Mm01_00118984 predicted 1392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018365
VALIDATED
MNS1 MISSION shRNA Bacterial Glycerol Stock
meiosis-specific nuclear structural 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018365.1-1696s1c1
Sequence:CCGGCACTAGATGTCAGCATAACTTCTCGAGAAGTTATGCTGACATCTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018365.1-1123s1c1
Sequence:CCGGCGACAAGAATTATACCAGGAACTCGAGTTCCTGGTATAATTCTTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018365.1-691s1c1
Sequence:CCGGGCAGAAGACAAACGAAACAAACTCGAGTTTGTTTCGTTTGTCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018365.1-279s1c1
Sequence:CCGGCAGGAATCAAATGGTGCAGAACTCGAGTTCTGCACCATTTGATTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018365.1-1004s1c1
Sequence:CCGGGAGAAGAAGATCGGATGGCAACTCGAGTTGCCATCCGATCTTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018365.1-1315s1c1
Sequence:CCGGGCTGAGGATGATCGAATAGAACTCGAGTTCTATTCGATCATCCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018365.1-367s1c1
Sequence:CCGGGATATGGAAGAGGCCATTCAACTCGAGTTGAATGGCCTCTTCCATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018365.1-1730s1c1
Sequence:CCGGCAGTGGCATTAGGTATCCATTCTCGAGAATGGATACCTAATGCCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018365.1-1426s1c1
Sequence:CCGGGCAGACAAACAACGTGAACTACTCGAGTAGTTCACGTTGTTTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018365.1-321s1c1
Sequence:CCGGGCGCAAGCAATTTCTCAGATTCTCGAGAATCTGAGAAATTGCTTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018365.1-1531s1c1
Sequence:CCGGGCTACAAACTTACTAGGCTATCTCGAGATAGCCTAGTAAGTTTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018365
VALIDATED
MNS1 MISSION shRNA shRNA Plasmid DNA
meiosis-specific nuclear structural 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018365.1-1696s1c1
Sequence:CCGGCACTAGATGTCAGCATAACTTCTCGAGAAGTTATGCTGACATCTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018365.1-1123s1c1
Sequence:CCGGCGACAAGAATTATACCAGGAACTCGAGTTCCTGGTATAATTCTTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018365.1-691s1c1
Sequence:CCGGGCAGAAGACAAACGAAACAAACTCGAGTTTGTTTCGTTTGTCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018365.1-279s1c1
Sequence:CCGGCAGGAATCAAATGGTGCAGAACTCGAGTTCTGCACCATTTGATTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018365.1-1004s1c1
Sequence:CCGGGAGAAGAAGATCGGATGGCAACTCGAGTTGCCATCCGATCTTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018365.1-1315s1c1
Sequence:CCGGGCTGAGGATGATCGAATAGAACTCGAGTTCTATTCGATCATCCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018365.1-367s1c1
Sequence:CCGGGATATGGAAGAGGCCATTCAACTCGAGTTGAATGGCCTCTTCCATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018365.1-1730s1c1
Sequence:CCGGCAGTGGCATTAGGTATCCATTCTCGAGAATGGATACCTAATGCCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018365.1-1426s1c1
Sequence:CCGGGCAGACAAACAACGTGAACTACTCGAGTAGTTCACGTTGTTTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018365.1-321s1c1
Sequence:CCGGGCGCAAGCAATTTCTCAGATTCTCGAGAATCTGAGAAATTGCTTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018365.1-1531s1c1
Sequence:CCGGGCTACAAACTTACTAGGCTATCTCGAGATAGCCTAGTAAGTTTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018365
VALIDATED
MNS1 MISSION shRNA Lentiviral Transduction Particles
meiosis-specific nuclear structural 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018365.1-1696s1c1
Sequence:CCGGCACTAGATGTCAGCATAACTTCTCGAGAAGTTATGCTGACATCTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018365.1-1123s1c1
Sequence:CCGGCGACAAGAATTATACCAGGAACTCGAGTTCCTGGTATAATTCTTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018365.1-691s1c1
Sequence:CCGGGCAGAAGACAAACGAAACAAACTCGAGTTTGTTTCGTTTGTCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018365.1-279s1c1
Sequence:CCGGCAGGAATCAAATGGTGCAGAACTCGAGTTCTGCACCATTTGATTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018365.1-1004s1c1
Sequence:CCGGGAGAAGAAGATCGGATGGCAACTCGAGTTGCCATCCGATCTTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018365.1-1315s1c1
Sequence:CCGGGCTGAGGATGATCGAATAGAACTCGAGTTCTATTCGATCATCCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018365.1-367s1c1
Sequence:CCGGGATATGGAAGAGGCCATTCAACTCGAGTTGAATGGCCTCTTCCATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018365.1-1730s1c1
Sequence:CCGGCAGTGGCATTAGGTATCCATTCTCGAGAATGGATACCTAATGCCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018365.1-1426s1c1
Sequence:CCGGGCAGACAAACAACGTGAACTACTCGAGTAGTTCACGTTGTTTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018365.1-321s1c1
Sequence:CCGGGCGCAAGCAATTTCTCAGATTCTCGAGAATCTGAGAAATTGCTTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018365.1-1531s1c1
Sequence:CCGGGCTACAAACTTACTAGGCTATCTCGAGATAGCCTAGTAAGTTTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008613
VALIDATED
MNS1 MISSION shRNA Bacterial Glycerol Stock
meiosis-specific nuclear structural 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008613.2-1656s21c1
Sequence:CCGGAGCCGAGTCTTCATAGCAAGGCTCGAGCCTTGCTATGAAGACTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008613.2-256s21c1
Sequence:CCGGTGAACATACAAGTCATGAATACTCGAGTATTCATGACTTGTATGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008613.2-895s21c1
Sequence:CCGGATGCAATTCAGAAGTATATTGCTCGAGCAATATACTTCTGAATTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008613.2-634s21c1
Sequence:CCGGTGAAACGTGATGCGGAGATAGCTCGAGCTATCTCCGCATCACGTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008613.2-815s21c1
Sequence:CCGGGAAACTCATGATAGACGAAATCTCGAGATTTCGTCTATCATGAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008613
VALIDATED
MNS1 MISSION shRNA shRNA Plasmid DNA
meiosis-specific nuclear structural 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008613.2-1656s21c1
Sequence:CCGGAGCCGAGTCTTCATAGCAAGGCTCGAGCCTTGCTATGAAGACTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008613.2-256s21c1
Sequence:CCGGTGAACATACAAGTCATGAATACTCGAGTATTCATGACTTGTATGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008613.2-895s21c1
Sequence:CCGGATGCAATTCAGAAGTATATTGCTCGAGCAATATACTTCTGAATTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008613.2-634s21c1
Sequence:CCGGTGAAACGTGATGCGGAGATAGCTCGAGCTATCTCCGCATCACGTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008613.2-815s21c1
Sequence:CCGGGAAACTCATGATAGACGAAATCTCGAGATTTCGTCTATCATGAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008613
VALIDATED
MNS1 MISSION shRNA Lentiviral Transduction Particles
meiosis-specific nuclear structural 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008613.2-1656s21c1
Sequence:CCGGAGCCGAGTCTTCATAGCAAGGCTCGAGCCTTGCTATGAAGACTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008613.2-256s21c1
Sequence:CCGGTGAACATACAAGTCATGAATACTCGAGTATTCATGACTTGTATGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008613.2-895s21c1
Sequence:CCGGATGCAATTCAGAAGTATATTGCTCGAGCAATATACTTCTGAATTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008613.2-634s21c1
Sequence:CCGGTGAAACGTGATGCGGAGATAGCTCGAGCTATCTCCGCATCACGTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008613.2-815s21c1
Sequence:CCGGGAAACTCATGATAGACGAAATCTCGAGATTTCGTCTATCATGAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)