EMAIL THIS PAGE TO A FRIEND

MNT

MNT, MAX dimerization protein

141 Gene Product Result for
Synonyms: MAD6 MXD6 ROX bHLHd3
UniProtKB ID: Q99583, A8K6D1, D3DTI7, Q1ED38
Gene ID:
Human(4335) Summary: The Myc/Max/Mad network comprises a group of transcription factors that co-interact to regulate gene-specific transcriptional activation or repression. This gene encodes a protein member of the Myc/Max/Mad network. This protein has a basic-Helix-Loop-Helix-zipper domain (bHLHzip) with which it binds the canonical DNA sequence CANNTG, known as the E box, following heterodimerization with Max proteins. This protein is likely a transcriptional repressor and an antagonist of Myc-dependent transcriptional activation and cell growth. This protein represses transcription by binding to DNA binding proteins at its N-terminal Sin3-interaction domain. [provided by RefSeq, Jul 2008]
Mouse(17428) max binding protein
Rat(287521) MNT, MAX dimerization protein
sheep(101105013) MNT, MAX dimerization protein
domestic guinea pig(100735279) MNT, MAX dimerization protein
naked mole-rat(101708474) MNT, MAX dimerization protein
fruit fly(31331) CG13316 gene product from transcript CG13316-RD
cow(618576) MAX binding protein
domestic cat(101098414) MAX binding protein
dog(491202) MAX binding protein
chicken(427840) MAX binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010813 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010813 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010813 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020310 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020310 Rosetta Predictions human pricing
NM_001105807 Rosetta Predictions rat pricing
NM_010813 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353224 predicted 906
2 SASI_Hs01_00094368 predicted 2400
3 SASI_Hs01_00094370 predicted 1798
4 SASI_Hs01_00094371 predicted 1012
5 SASI_Hs01_00094372 predicted 1045
6 SASI_Hs01_00094373 predicted 2402
7 SASI_Hs01_00094374 predicted 1042
8 SASI_Hs01_00094375 predicted 1062
9 SASI_Hs01_00094376 predicted 867
10 SASI_Hs01_00094377 predicted 2412
11 SASI_Hs01_00094369 predicted 1795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105807 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212726 predicted 1991
2 SASI_Rn02_00212727 predicted 1321
3 SASI_Rn02_00212728 predicted 1995
4 SASI_Rn02_00212729 predicted 1758
5 SASI_Rn02_00212730 predicted 1019
6 SASI_Rn02_00212731 predicted 1988
7 SASI_Rn02_00212732 predicted 2140
8 SASI_Rn02_00212733 predicted 1981
9 SASI_Rn02_00212734 predicted 1001
10 SASI_Rn02_00212735 predicted 1224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048603 predicted 1064
2 SASI_Mm02_00319408 predicted 2501
3 SASI_Mm01_00048605 predicted 1102
4 SASI_Mm01_00048606 predicted 1000
5 SASI_Mm01_00048607 predicted 1267
6 SASI_Mm01_00048608 predicted 928
7 SASI_Mm01_00048609 predicted 1154
8 SASI_Mm01_00048610 predicted 1320
9 SASI_Mm01_00048612 predicted 1203
10 SASI_Mm02_00319409 predicted 1802
11 SASI_Mm01_00048604 predicted 1976
12 SASI_Mm01_00048611 predicted 1771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010813
MNT MISSION shRNA Bacterial Glycerol Stock
MNT, MAX dimerization protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010813.3-680s21c1
Sequence:CCGGCTATTCCTGTAGTGACCAATTCTCGAGAATTGGTCACTACAGGAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010813.3-2003s21c1
Sequence:CCGGTGTCGCACCAGCAAGTAAATGCTCGAGCATTTACTTGCTGGTGCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010813.3-1016s21c1
Sequence:CCGGCACCGGCTGAAGAAGCCAAATCTCGAGATTTGGCTTCTTCAGCCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010813.3-4107s21c1
Sequence:CCGGGCTCACTGCCTGGGATCTTTACTCGAGTAAAGATCCCAGGCAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010813.2-3848s1c1
Sequence:CCGGCCGAATGACTATGTCCAGATTCTCGAGAATCTGGACATAGTCATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010813.2-664s1c1
Sequence:CCGGCCACTGACTGTCATTCCTATTCTCGAGAATAGGAATGACAGTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010813.2-2002s1c1
Sequence:CCGGCTGTCGCACCAGCAAGTAAATCTCGAGATTTACTTGCTGGTGCGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010813.2-679s1c1
Sequence:CCGGCCTATTCCTGTAGTGACCAATCTCGAGATTGGTCACTACAGGAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010813
MNT MISSION shRNA shRNA Plasmid DNA
MNT, MAX dimerization protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010813.3-680s21c1
Sequence:CCGGCTATTCCTGTAGTGACCAATTCTCGAGAATTGGTCACTACAGGAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010813.3-2003s21c1
Sequence:CCGGTGTCGCACCAGCAAGTAAATGCTCGAGCATTTACTTGCTGGTGCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010813.3-1016s21c1
Sequence:CCGGCACCGGCTGAAGAAGCCAAATCTCGAGATTTGGCTTCTTCAGCCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010813.3-4107s21c1
Sequence:CCGGGCTCACTGCCTGGGATCTTTACTCGAGTAAAGATCCCAGGCAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010813.2-3848s1c1
Sequence:CCGGCCGAATGACTATGTCCAGATTCTCGAGAATCTGGACATAGTCATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010813.2-664s1c1
Sequence:CCGGCCACTGACTGTCATTCCTATTCTCGAGAATAGGAATGACAGTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010813.2-2002s1c1
Sequence:CCGGCTGTCGCACCAGCAAGTAAATCTCGAGATTTACTTGCTGGTGCGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010813.2-679s1c1
Sequence:CCGGCCTATTCCTGTAGTGACCAATCTCGAGATTGGTCACTACAGGAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010813
MNT MISSION shRNA Lentiviral Transduction Particles
MNT, MAX dimerization protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010813.3-680s21c1
Sequence:CCGGCTATTCCTGTAGTGACCAATTCTCGAGAATTGGTCACTACAGGAATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010813.3-2003s21c1
Sequence:CCGGTGTCGCACCAGCAAGTAAATGCTCGAGCATTTACTTGCTGGTGCGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010813.3-1016s21c1
Sequence:CCGGCACCGGCTGAAGAAGCCAAATCTCGAGATTTGGCTTCTTCAGCCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010813.3-4107s21c1
Sequence:CCGGGCTCACTGCCTGGGATCTTTACTCGAGTAAAGATCCCAGGCAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010813.2-3848s1c1
Sequence:CCGGCCGAATGACTATGTCCAGATTCTCGAGAATCTGGACATAGTCATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010813.2-664s1c1
Sequence:CCGGCCACTGACTGTCATTCCTATTCTCGAGAATAGGAATGACAGTCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010813.2-2002s1c1
Sequence:CCGGCTGTCGCACCAGCAAGTAAATCTCGAGATTTACTTGCTGGTGCGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010813.2-679s1c1
Sequence:CCGGCCTATTCCTGTAGTGACCAATCTCGAGATTGGTCACTACAGGAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020310
VALIDATED
MNT MISSION shRNA Bacterial Glycerol Stock
MNT, MAX dimerization protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_020310.2-366s21c1
Sequence:CCGGGGAACAGAAGAAGGCCAATAGCTCGAGCTATTGGCCTTCTTCTGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020310.2-857s21c1
Sequence:CCGGCACCAGCTGAAGAAGTCAAATCTCGAGATTTGACTTCTTCAGCTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020310.2-2627s21c1
Sequence:CCGGTTACCGTAGATACTACTTAAACTCGAGTTTAAGTAGTATCTACGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020310.2-1260s21c1
Sequence:CCGGGGACAACATAGACGAGGATATCTCGAGATATCCTCGTCTATGTTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020310.1-3993s1c1
Sequence:CCGGCCTGCAAATCTAGTGCCGAAACTCGAGTTTCGGCACTAGATTTGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020310.1-1218s1c1
Sequence:CCGGGAGGACAACATAGACGAGGATCTCGAGATCCTCGTCTATGTTGTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020310.1-884s1c1
Sequence:CCGGCCACAACAAATTGGAGAAGAACTCGAGTTCTTCTCCAATTTGTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020310.1-1823s1c1
Sequence:CCGGCCCGGCTACTGTCATGGCAAACTCGAGTTTGCCATGACAGTAGCCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020310.1-816s1c1
Sequence:CCGGGCACCAGCTGAAGAAGTCAAACTCGAGTTTGACTTCTTCAGCTGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020310
VALIDATED
MNT MISSION shRNA shRNA Plasmid DNA
MNT, MAX dimerization protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_020310.2-366s21c1
Sequence:CCGGGGAACAGAAGAAGGCCAATAGCTCGAGCTATTGGCCTTCTTCTGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020310.2-857s21c1
Sequence:CCGGCACCAGCTGAAGAAGTCAAATCTCGAGATTTGACTTCTTCAGCTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020310.2-2627s21c1
Sequence:CCGGTTACCGTAGATACTACTTAAACTCGAGTTTAAGTAGTATCTACGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020310.2-1260s21c1
Sequence:CCGGGGACAACATAGACGAGGATATCTCGAGATATCCTCGTCTATGTTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020310.1-3993s1c1
Sequence:CCGGCCTGCAAATCTAGTGCCGAAACTCGAGTTTCGGCACTAGATTTGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020310.1-1218s1c1
Sequence:CCGGGAGGACAACATAGACGAGGATCTCGAGATCCTCGTCTATGTTGTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020310.1-884s1c1
Sequence:CCGGCCACAACAAATTGGAGAAGAACTCGAGTTCTTCTCCAATTTGTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020310.1-1823s1c1
Sequence:CCGGCCCGGCTACTGTCATGGCAAACTCGAGTTTGCCATGACAGTAGCCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020310.1-816s1c1
Sequence:CCGGGCACCAGCTGAAGAAGTCAAACTCGAGTTTGACTTCTTCAGCTGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020310
VALIDATED
MNT MISSION shRNA Lentiviral Transduction Particles
MNT, MAX dimerization protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_020310.2-366s21c1
Sequence:CCGGGGAACAGAAGAAGGCCAATAGCTCGAGCTATTGGCCTTCTTCTGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020310.2-857s21c1
Sequence:CCGGCACCAGCTGAAGAAGTCAAATCTCGAGATTTGACTTCTTCAGCTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020310.2-2627s21c1
Sequence:CCGGTTACCGTAGATACTACTTAAACTCGAGTTTAAGTAGTATCTACGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020310.2-1260s21c1
Sequence:CCGGGGACAACATAGACGAGGATATCTCGAGATATCCTCGTCTATGTTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020310.1-3993s1c1
Sequence:CCGGCCTGCAAATCTAGTGCCGAAACTCGAGTTTCGGCACTAGATTTGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020310.1-1218s1c1
Sequence:CCGGGAGGACAACATAGACGAGGATCTCGAGATCCTCGTCTATGTTGTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020310.1-884s1c1
Sequence:CCGGCCACAACAAATTGGAGAAGAACTCGAGTTCTTCTCCAATTTGTTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020310.1-1823s1c1
Sequence:CCGGCCCGGCTACTGTCATGGCAAACTCGAGTTTGCCATGACAGTAGCCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020310.1-816s1c1
Sequence:CCGGGCACCAGCTGAAGAAGTCAAACTCGAGTTTGACTTCTTCAGCTGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)