EMAIL THIS PAGE TO A FRIEND

MNX1

motor neuron and pancreas homeobox 1

56 Gene Product Result for
Synonyms: HB9 HLXB9 HOXHB9 SCRA1
UniProtKB ID: P50219, F5H401, Q9Y648
Gene ID:
Human(3110) Summary: This gene encodes a nuclear protein, which contains a homeobox domain and is a transcription factor. Mutations in this gene result in Currarino syndrome, an autosomic dominant congenital malformation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(15285) motor neuron and pancreas homeobox 1
Rat(682076) motor neuron and pancreas homeobox 1
Zebrafish(405399) motor neuron and pancreas homeobox 1
dog(482821) motor neuron and pancreas homeobox 1
cow(789765) motor neuron and pancreas homeobox 1
chicken(395768) motor neuron and pancreas homeobox 1
naked mole-rat(101717819) motor neuron and pancreas homeobox 1
domestic guinea pig(100723175) motor neuron and pancreas homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019944 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019944 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019944 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005515 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005515 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005515 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005515 Rosetta Predictions human pricing
XM_001059733 Rosetta Predictions rat pricing
NM_019944 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095138 predicted 1938
2 SASI_Hs01_00095139 predicted 1899
3 SASI_Hs01_00095140 predicted 1900
4 SASI_Hs02_00339730 predicted 1805
5 SASI_Hs01_00095141 predicted 1804
6 SASI_Hs01_00095142 predicted 1890
7 SASI_Hs02_00339731 predicted 1926
8 SASI_Hs01_00095143 predicted 1891
9 SASI_Hs01_00095144 predicted 1878
10 SASI_Hs02_00339732 predicted 1923
11 SASI_Hs01_00095145 predicted 1940
12 SASI_Hs01_00095146 predicted 1913
13 SASI_Hs01_00095147 predicted 1903
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059733 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294153 predicted 657
2 SASI_Rn02_00294154 predicted 872
3 SASI_Rn02_00294155 predicted 876
4 SASI_Rn02_00294156 predicted 755
5 SASI_Rn02_00294157 predicted 666
6 SASI_Rn02_00294158 predicted 871
7 SASI_Rn02_00294159 predicted 641
8 SASI_Rn02_00294160 predicted 762
9 SASI_Rn02_00294161 predicted 956
10 SASI_Rn02_00294162 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183400 predicted 1591
2 SASI_Mm01_00183401 predicted 1288
3 SASI_Mm01_00183402 predicted 985
4 SASI_Mm01_00183403 predicted 1062
5 SASI_Mm01_00183404 predicted 678
6 SASI_Mm01_00183405 predicted 662
7 SASI_Mm01_00183406 predicted 874
8 SASI_Mm01_00183407 predicted 1590
9 SASI_Mm01_00183408 predicted 1157
10 SASI_Mm01_00183409 predicted 840
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019944
MNX1 MISSION shRNA Bacterial Glycerol Stock
motor neuron and pancreas homeobox 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019944.1-1070s1c1
Sequence:CCGGGCCGAATGAAATGGAAACGCACTCGAGTGCGTTTCCATTTCATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019944.1-1284s1c1
Sequence:CCGGAGAAGAGGACAACTTCCCGTACTCGAGTACGGGAAGTTGTCCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019944.1-840s1c1
Sequence:CCGGCGCGTCTACTGCGGGCATGATCTCGAGATCATGCCCGCAGTAGACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019944.1-738s1c1
Sequence:CCGGGCTTTCCTACTCATACCCTCACTCGAGTGAGGGTATGAGTAGGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019944.1-966s1c1
Sequence:CCGGACACCAGTTCAAGCTCAACAACTCGAGTTGTTGAGCTTGAACTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019944.2-675s21c1
Sequence:CCGGACACCCGGTCTACAGTTATTCCTCGAGGAATAACTGTAGACCGGGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019944.2-1167s21c1
Sequence:CCGGCAGTGAGGAGAAGACGGAAGACTCGAGTCTTCCGTCTTCTCCTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019944.2-1039s21c1
Sequence:CCGGGAGACTCAGGTGAAGATTTGGCTCGAGCCAAATCTTCACCTGAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019944
MNX1 MISSION shRNA shRNA Plasmid DNA
motor neuron and pancreas homeobox 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019944.1-1070s1c1
Sequence:CCGGGCCGAATGAAATGGAAACGCACTCGAGTGCGTTTCCATTTCATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019944.1-1284s1c1
Sequence:CCGGAGAAGAGGACAACTTCCCGTACTCGAGTACGGGAAGTTGTCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019944.1-840s1c1
Sequence:CCGGCGCGTCTACTGCGGGCATGATCTCGAGATCATGCCCGCAGTAGACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019944.1-738s1c1
Sequence:CCGGGCTTTCCTACTCATACCCTCACTCGAGTGAGGGTATGAGTAGGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019944.1-966s1c1
Sequence:CCGGACACCAGTTCAAGCTCAACAACTCGAGTTGTTGAGCTTGAACTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019944.2-675s21c1
Sequence:CCGGACACCCGGTCTACAGTTATTCCTCGAGGAATAACTGTAGACCGGGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019944.2-1167s21c1
Sequence:CCGGCAGTGAGGAGAAGACGGAAGACTCGAGTCTTCCGTCTTCTCCTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019944.2-1039s21c1
Sequence:CCGGGAGACTCAGGTGAAGATTTGGCTCGAGCCAAATCTTCACCTGAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019944
MNX1 MISSION shRNA Lentiviral Transduction Particles
motor neuron and pancreas homeobox 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019944.1-1070s1c1
Sequence:CCGGGCCGAATGAAATGGAAACGCACTCGAGTGCGTTTCCATTTCATTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019944.1-1284s1c1
Sequence:CCGGAGAAGAGGACAACTTCCCGTACTCGAGTACGGGAAGTTGTCCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019944.1-840s1c1
Sequence:CCGGCGCGTCTACTGCGGGCATGATCTCGAGATCATGCCCGCAGTAGACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019944.1-738s1c1
Sequence:CCGGGCTTTCCTACTCATACCCTCACTCGAGTGAGGGTATGAGTAGGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019944.1-966s1c1
Sequence:CCGGACACCAGTTCAAGCTCAACAACTCGAGTTGTTGAGCTTGAACTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019944.2-675s21c1
Sequence:CCGGACACCCGGTCTACAGTTATTCCTCGAGGAATAACTGTAGACCGGGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019944.2-1167s21c1
Sequence:CCGGCAGTGAGGAGAAGACGGAAGACTCGAGTCTTCCGTCTTCTCCTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019944.2-1039s21c1
Sequence:CCGGGAGACTCAGGTGAAGATTTGGCTCGAGCCAAATCTTCACCTGAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005515
MNX1 MISSION shRNA Bacterial Glycerol Stock
motor neuron and pancreas homeobox 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005515.2-1781s1c1
Sequence:CCGGCCACAGTGTTACCTGACTTATCTCGAGATAAGTCAGGTAACACTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005515.2-1270s1c1
Sequence:CCGGCGAGGACGACGAGGACCATTTCTCGAGAAATGGTCCTCGTCGTCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005515.2-1108s1c1
Sequence:CCGGGCAGGAAGCGGAGAAACAGAACTCGAGTTCTGTTTCTCCGCTTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005515.2-958s1c1
Sequence:CCGGGCACCAGTTCAAGCTCAACAACTCGAGTTGTTGAGCTTGAACTGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005515.2-853s1c1
Sequence:CCGGCCTGCCTAAGATGCCCGACTTCTCGAGAAGTCGGGCATCTTAGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005515.3-1711s21c1
Sequence:CCGGCTCACCTGCTCTTCAAGAAACCTCGAGGTTTCTTGAAGAGCAGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005515.3-1939s21c1
Sequence:CCGGGCCGCCATTCTGCAGAGTATTCTCGAGAATACTCTGCAGAATGGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005515.3-1147s21c1
Sequence:CCGGGAGACCCAGGTGAAGATTTGGCTCGAGCCAAATCTTCACCTGGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005515.3-1179s21c1
Sequence:CCGGGCGGATGAAATGGAAACGCAGCTCGAGCTGCGTTTCCATTTCATCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005515.3-1756s21c1
Sequence:CCGGGAAACTTGAACTCTGGTTCTTCTCGAGAAGAACCAGAGTTCAAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005515
MNX1 MISSION shRNA shRNA Plasmid DNA
motor neuron and pancreas homeobox 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005515.2-1781s1c1
Sequence:CCGGCCACAGTGTTACCTGACTTATCTCGAGATAAGTCAGGTAACACTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005515.2-1270s1c1
Sequence:CCGGCGAGGACGACGAGGACCATTTCTCGAGAAATGGTCCTCGTCGTCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005515.2-1108s1c1
Sequence:CCGGGCAGGAAGCGGAGAAACAGAACTCGAGTTCTGTTTCTCCGCTTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005515.2-958s1c1
Sequence:CCGGGCACCAGTTCAAGCTCAACAACTCGAGTTGTTGAGCTTGAACTGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005515.2-853s1c1
Sequence:CCGGCCTGCCTAAGATGCCCGACTTCTCGAGAAGTCGGGCATCTTAGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005515.3-1711s21c1
Sequence:CCGGCTCACCTGCTCTTCAAGAAACCTCGAGGTTTCTTGAAGAGCAGGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005515.3-1939s21c1
Sequence:CCGGGCCGCCATTCTGCAGAGTATTCTCGAGAATACTCTGCAGAATGGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005515.3-1147s21c1
Sequence:CCGGGAGACCCAGGTGAAGATTTGGCTCGAGCCAAATCTTCACCTGGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005515.3-1179s21c1
Sequence:CCGGGCGGATGAAATGGAAACGCAGCTCGAGCTGCGTTTCCATTTCATCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005515.3-1756s21c1
Sequence:CCGGGAAACTTGAACTCTGGTTCTTCTCGAGAAGAACCAGAGTTCAAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005515
MNX1 MISSION shRNA Lentiviral Transduction Particles
motor neuron and pancreas homeobox 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005515.2-1781s1c1
Sequence:CCGGCCACAGTGTTACCTGACTTATCTCGAGATAAGTCAGGTAACACTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005515.2-1270s1c1
Sequence:CCGGCGAGGACGACGAGGACCATTTCTCGAGAAATGGTCCTCGTCGTCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005515.2-1108s1c1
Sequence:CCGGGCAGGAAGCGGAGAAACAGAACTCGAGTTCTGTTTCTCCGCTTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005515.2-958s1c1
Sequence:CCGGGCACCAGTTCAAGCTCAACAACTCGAGTTGTTGAGCTTGAACTGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005515.2-853s1c1
Sequence:CCGGCCTGCCTAAGATGCCCGACTTCTCGAGAAGTCGGGCATCTTAGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005515.3-1711s21c1
Sequence:CCGGCTCACCTGCTCTTCAAGAAACCTCGAGGTTTCTTGAAGAGCAGGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005515.3-1939s21c1
Sequence:CCGGGCCGCCATTCTGCAGAGTATTCTCGAGAATACTCTGCAGAATGGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005515.3-1147s21c1
Sequence:CCGGGAGACCCAGGTGAAGATTTGGCTCGAGCCAAATCTTCACCTGGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005515.3-1179s21c1
Sequence:CCGGGCGGATGAAATGGAAACGCAGCTCGAGCTGCGTTTCCATTTCATCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005515.3-1756s21c1
Sequence:CCGGGAAACTTGAACTCTGGTTCTTCTCGAGAAGAACCAGAGTTCAAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)