EMAIL THIS PAGE TO A FRIEND

MOAP1

modulator of apoptosis 1

53 Gene Product Result for
Synonyms: MAP-1 PNMA4
UniProtKB ID: Q96BY2, B2RDF6, Q9H833, Q9HAS1
Gene ID:
Human(64112) Summary: The protein encoded by this gene was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, this gene has been shown to mediate caspase-dependent apoptosis. [provided by RefSeq, Jul 2008]
Mouse(64113) modulator of apoptosis 1
Rat(299261) modulator of apoptosis 1
domestic cat(101098962) modulator of apoptosis 1
cow(100139785) modulator of apoptosis 1
dog(100682745) modulator of apoptosis 1
sheep(101112766) modulator of apoptosis 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022151 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022151 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022151 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022323 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022323 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022323 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022151 Rosetta Predictions human pricing
NM_001013101 Rosetta Predictions rat pricing
NM_022323 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133479 predicted 1054
2 SASI_Hs01_00133480 predicted 1390
3 SASI_Hs01_00133481 predicted 626
4 SASI_Hs01_00133482 predicted 1113
5 SASI_Hs01_00133483 predicted 1338
6 SASI_Hs01_00133484 predicted 1330
7 SASI_Hs01_00133485 predicted 1390
8 SASI_Hs01_00133487 predicted 911
9 SASI_Hs01_00133488 predicted 1014
10 SASI_Hs02_00355566 predicted 420
11 SASI_Hs01_00133486 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096523 predicted 617
2 SASI_Rn02_00200765 predicted 1091
3 SASI_Rn01_00096524 predicted 801
4 SASI_Rn01_00096526 predicted 516
5 SASI_Rn02_00200766 predicted 950
6 SASI_Rn01_00096527 predicted 783
7 SASI_Rn01_00096529 predicted 1206
8 SASI_Rn01_00096530 predicted 1381
9 SASI_Rn01_00096531 predicted 692
10 SASI_Rn01_00096532 predicted 922
11 SASI_Rn01_00096525 predicted 405
12 SASI_Rn01_00096528 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022323 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131113 predicted 1671
2 SASI_Mm02_00326557 predicted 2280
3 SASI_Mm02_00326558 predicted 2374
4 SASI_Mm01_00131114 predicted 1935
5 SASI_Mm02_00326559 predicted 2083
6 SASI_Mm01_00131116 predicted 1678
7 SASI_Mm01_00131117 predicted 2144
8 SASI_Mm01_00131118 predicted 1780
9 SASI_Mm01_00131120 predicted 1966
10 SASI_Mm01_00131122 predicted 1982
11 SASI_Mm01_00131115 predicted 1524
12 SASI_Mm01_00131119 predicted 1682
13 SASI_Mm01_00131121 predicted 1971
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022151
VALIDATED
MOAP1 MISSION shRNA Bacterial Glycerol Stock
modulator of apoptosis 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022151.4-1337s21c1
Sequence:CCGGTTGCAGTTATTGGTACTAATACTCGAGTATTAGTACCAATAACTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022151.4-1073s21c1
Sequence:CCGGCAGGCTCTTGAGGAGGTATTTCTCGAGAAATACCTCCTCAAGAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022151.4-1565s21c1
Sequence:CCGGTGTCGTTTCTGTGCCTATTTACTCGAGTAAATAGGCACAGAAACGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022151.4-1399s21c1
Sequence:CCGGGGCAATATTGGAAGGTAATTTCTCGAGAAATTACCTTCCAATATTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022151.4-415s21c1
Sequence:CCGGGAACCCTCGGAAAGCGCTATTCTCGAGAATAGCGCTTTCCGAGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022151.3-1066s1c1
Sequence:CCGGCAGGCTCTTGAGGAGGTATTTCTCGAGAAATACCTCCTCAAGAGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022151.3-1329s1c1
Sequence:CCGGCTTGCAGTTATTGGTACTAATCTCGAGATTAGTACCAATAACTGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022151.3-915s1c1
Sequence:CCGGGATGTTTCATACTACTCAGATCTCGAGATCTGAGTAGTATGAAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022151.3-1570s1c1
Sequence:CCGGGCCTATTTAAAGTCTCCTAAACTCGAGTTTAGGAGACTTTAAATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022151.3-2179s1c1
Sequence:CCGGCGGAGGTTAAGATATTAAGTTCTCGAGAACTTAATATCTTAACCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022151.3-1390s1c1
Sequence:CCGGCAGGCAATATTGGAAGGTAATCTCGAGATTACCTTCCAATATTGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160636    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022151.3-1963s1c1
Sequence:CCGGCCCTGTGAATTTCTTATTGTACTCGAGTACAATAAGAAATTCACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022151.3-1389s1c1
Sequence:CCGGCCAGGCAATATTGGAAGGTAACTCGAGTTACCTTCCAATATTGCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022151.3-1183s1c1
Sequence:CCGGCCTTTGTTACAGAAGCTGGTACTCGAGTACCAGCTTCTGTAACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022151.3-412s1c1
Sequence:CCGGCCTCGGAAAGCGCTATTGATTCTCGAGAATCAATAGCGCTTTCCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022151
VALIDATED
MOAP1 MISSION shRNA shRNA Plasmid DNA
modulator of apoptosis 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022151.4-1337s21c1
Sequence:CCGGTTGCAGTTATTGGTACTAATACTCGAGTATTAGTACCAATAACTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022151.4-1073s21c1
Sequence:CCGGCAGGCTCTTGAGGAGGTATTTCTCGAGAAATACCTCCTCAAGAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022151.4-1565s21c1
Sequence:CCGGTGTCGTTTCTGTGCCTATTTACTCGAGTAAATAGGCACAGAAACGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022151.4-1399s21c1
Sequence:CCGGGGCAATATTGGAAGGTAATTTCTCGAGAAATTACCTTCCAATATTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022151.4-415s21c1
Sequence:CCGGGAACCCTCGGAAAGCGCTATTCTCGAGAATAGCGCTTTCCGAGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022151.3-1066s1c1
Sequence:CCGGCAGGCTCTTGAGGAGGTATTTCTCGAGAAATACCTCCTCAAGAGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022151.3-1329s1c1
Sequence:CCGGCTTGCAGTTATTGGTACTAATCTCGAGATTAGTACCAATAACTGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022151.3-915s1c1
Sequence:CCGGGATGTTTCATACTACTCAGATCTCGAGATCTGAGTAGTATGAAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022151.3-1570s1c1
Sequence:CCGGGCCTATTTAAAGTCTCCTAAACTCGAGTTTAGGAGACTTTAAATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022151.3-2179s1c1
Sequence:CCGGCGGAGGTTAAGATATTAAGTTCTCGAGAACTTAATATCTTAACCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022151.3-1390s1c1
Sequence:CCGGCAGGCAATATTGGAAGGTAATCTCGAGATTACCTTCCAATATTGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160636    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022151.3-1963s1c1
Sequence:CCGGCCCTGTGAATTTCTTATTGTACTCGAGTACAATAAGAAATTCACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022151.3-1389s1c1
Sequence:CCGGCCAGGCAATATTGGAAGGTAACTCGAGTTACCTTCCAATATTGCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022151.3-1183s1c1
Sequence:CCGGCCTTTGTTACAGAAGCTGGTACTCGAGTACCAGCTTCTGTAACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022151.3-412s1c1
Sequence:CCGGCCTCGGAAAGCGCTATTGATTCTCGAGAATCAATAGCGCTTTCCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022151
VALIDATED
MOAP1 MISSION shRNA Lentiviral Transduction Particles
modulator of apoptosis 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022151.4-1337s21c1
Sequence:CCGGTTGCAGTTATTGGTACTAATACTCGAGTATTAGTACCAATAACTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022151.4-1073s21c1
Sequence:CCGGCAGGCTCTTGAGGAGGTATTTCTCGAGAAATACCTCCTCAAGAGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022151.4-1565s21c1
Sequence:CCGGTGTCGTTTCTGTGCCTATTTACTCGAGTAAATAGGCACAGAAACGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022151.4-1399s21c1
Sequence:CCGGGGCAATATTGGAAGGTAATTTCTCGAGAAATTACCTTCCAATATTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022151.4-415s21c1
Sequence:CCGGGAACCCTCGGAAAGCGCTATTCTCGAGAATAGCGCTTTCCGAGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022151.3-1066s1c1
Sequence:CCGGCAGGCTCTTGAGGAGGTATTTCTCGAGAAATACCTCCTCAAGAGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022151.3-1329s1c1
Sequence:CCGGCTTGCAGTTATTGGTACTAATCTCGAGATTAGTACCAATAACTGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022151.3-915s1c1
Sequence:CCGGGATGTTTCATACTACTCAGATCTCGAGATCTGAGTAGTATGAAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022151.3-1570s1c1
Sequence:CCGGGCCTATTTAAAGTCTCCTAAACTCGAGTTTAGGAGACTTTAAATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022151.3-2179s1c1
Sequence:CCGGCGGAGGTTAAGATATTAAGTTCTCGAGAACTTAATATCTTAACCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022151.3-1390s1c1
Sequence:CCGGCAGGCAATATTGGAAGGTAATCTCGAGATTACCTTCCAATATTGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160636    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022151.3-1963s1c1
Sequence:CCGGCCCTGTGAATTTCTTATTGTACTCGAGTACAATAAGAAATTCACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022151.3-1389s1c1
Sequence:CCGGCCAGGCAATATTGGAAGGTAACTCGAGTTACCTTCCAATATTGCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022151.3-1183s1c1
Sequence:CCGGCCTTTGTTACAGAAGCTGGTACTCGAGTACCAGCTTCTGTAACAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022151.3-412s1c1
Sequence:CCGGCCTCGGAAAGCGCTATTGATTCTCGAGAATCAATAGCGCTTTCCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022323
MOAP1 MISSION shRNA Bacterial Glycerol Stock
modulator of apoptosis 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022323.6-703s21c1
Sequence:CCGGCATGTTAGCACAGGCATTAAACTCGAGTTTAATGCCTGTGCTAACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022323.6-609s21c1
Sequence:CCGGGCATGACGATGGGTGAATTAACTCGAGTTAATTCACCCATCGTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022323.6-1300s21c1
Sequence:CCGGGGCCGAATTAGAAGGCTATTGCTCGAGCAATAGCCTTCTAATTCGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022323.6-925s21c1
Sequence:CCGGTATTCGAGTCCTCAAGATAAACTCGAGTTTATCTTGAGGACTCGAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022323.6-2997s21c1
Sequence:CCGGGCTGGTCTTTGACGCATATATCTCGAGATATATGCGTCAAAGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022323.3-2300s1c1
Sequence:CCGGCCAAGACCCAAGGCTGTCATGCTCGAGCATGACAGCCTTGGGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022323.3-1921s1c1
Sequence:CCGGCCCTTCATTACAGTTGCAGAACTCGAGTTCTGCAACTGTAATGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022323.3-2214s1c1
Sequence:CCGGGCAGTTGCTGACACTGATAAACTCGAGTTTATCAGTGTCAGCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022323.3-2015s1c1
Sequence:CCGGCTTATCAGAAGACTGATGAAACTCGAGTTTCATCAGTCTTCTGATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022323.3-1643s1c1
Sequence:CCGGCGGGCATAATGATCCCTGAAACTCGAGTTTCAGGGATCATTATGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022323
MOAP1 MISSION shRNA shRNA Plasmid DNA
modulator of apoptosis 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022323.6-703s21c1
Sequence:CCGGCATGTTAGCACAGGCATTAAACTCGAGTTTAATGCCTGTGCTAACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022323.6-609s21c1
Sequence:CCGGGCATGACGATGGGTGAATTAACTCGAGTTAATTCACCCATCGTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022323.6-1300s21c1
Sequence:CCGGGGCCGAATTAGAAGGCTATTGCTCGAGCAATAGCCTTCTAATTCGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022323.6-925s21c1
Sequence:CCGGTATTCGAGTCCTCAAGATAAACTCGAGTTTATCTTGAGGACTCGAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022323.6-2997s21c1
Sequence:CCGGGCTGGTCTTTGACGCATATATCTCGAGATATATGCGTCAAAGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022323.3-2300s1c1
Sequence:CCGGCCAAGACCCAAGGCTGTCATGCTCGAGCATGACAGCCTTGGGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022323.3-1921s1c1
Sequence:CCGGCCCTTCATTACAGTTGCAGAACTCGAGTTCTGCAACTGTAATGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022323.3-2214s1c1
Sequence:CCGGGCAGTTGCTGACACTGATAAACTCGAGTTTATCAGTGTCAGCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022323.3-2015s1c1
Sequence:CCGGCTTATCAGAAGACTGATGAAACTCGAGTTTCATCAGTCTTCTGATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022323.3-1643s1c1
Sequence:CCGGCGGGCATAATGATCCCTGAAACTCGAGTTTCAGGGATCATTATGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022323
MOAP1 MISSION shRNA Lentiviral Transduction Particles
modulator of apoptosis 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022323.6-703s21c1
Sequence:CCGGCATGTTAGCACAGGCATTAAACTCGAGTTTAATGCCTGTGCTAACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022323.6-609s21c1
Sequence:CCGGGCATGACGATGGGTGAATTAACTCGAGTTAATTCACCCATCGTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022323.6-1300s21c1
Sequence:CCGGGGCCGAATTAGAAGGCTATTGCTCGAGCAATAGCCTTCTAATTCGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022323.6-925s21c1
Sequence:CCGGTATTCGAGTCCTCAAGATAAACTCGAGTTTATCTTGAGGACTCGAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022323.6-2997s21c1
Sequence:CCGGGCTGGTCTTTGACGCATATATCTCGAGATATATGCGTCAAAGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022323.3-2300s1c1
Sequence:CCGGCCAAGACCCAAGGCTGTCATGCTCGAGCATGACAGCCTTGGGTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022323.3-1921s1c1
Sequence:CCGGCCCTTCATTACAGTTGCAGAACTCGAGTTCTGCAACTGTAATGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022323.3-2214s1c1
Sequence:CCGGGCAGTTGCTGACACTGATAAACTCGAGTTTATCAGTGTCAGCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022323.3-2015s1c1
Sequence:CCGGCTTATCAGAAGACTGATGAAACTCGAGTTTCATCAGTCTTCTGATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022323.3-1643s1c1
Sequence:CCGGCGGGCATAATGATCCCTGAAACTCGAGTTTCAGGGATCATTATGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)