EMAIL THIS PAGE TO A FRIEND

MOB1A

MOB kinase activator 1A

86 Gene Product Result for
Synonyms: C2orf6 MATS1 MOB1 MOBK1B MOBKL1B Mob4B
UniProtKB ID: Q9H8S9, Q53S34, Q9H3T5, Q9HAI0, Q9NVE2
Gene ID:
Mouse(232157) MOB kinase activator 1A
Rat(297387) MOB kinase activator 1A
domestic guinea pig(100715406) MOB kinase activator 1A
naked mole-rat(101706344) MOB kinase activator 1A
sheep(101115526) MOB kinase activator 1A
Zebrafish(100005014) MOB kinase activator 1A
dog(612924) MOB kinase activator 1A
cow(614611) MOB kinase activator 1A
domestic cat(101099872) MOB kinase activator 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018221 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145571 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145571 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145571 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131841 MISSION® esiRNA esiRNA human MOBKL1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018221 Rosetta Predictions human pricing
NM_001033891 Rosetta Predictions rat pricing
XM_001068001 Rosetta Predictions rat pricing
XM_001068056 Rosetta Predictions rat pricing
NM_145571 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231852 predicted 865
2 SASI_Hs01_00231853 predicted 566
3 SASI_Hs01_00231854 predicted 918
4 SASI_Hs01_00231855 predicted 914
5 SASI_Hs02_00351531 predicted 257
6 SASI_Hs02_00351532 predicted 310
7 SASI_Hs01_00231856 predicted 905
8 SASI_Hs01_00231857 predicted 374
9 SASI_Hs01_00231858 predicted 757
10 SASI_Hs01_00231859 predicted 291
11 SASI_Hs01_00231860 predicted 526
12 SASI_Hs01_00231861 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116665 predicted 530
2 SASI_Rn01_00116666 predicted 539
3 SASI_Rn01_00116667 predicted 330
4 SASI_Rn01_00116668 predicted 631
5 SASI_Rn01_00116669 predicted 265
6 SASI_Rn01_00116670 predicted 226
7 SASI_Rn02_00203789 predicted 458
8 SASI_Rn01_00116671 predicted 233
9 SASI_Rn01_00116672 predicted 1264
10 SASI_Rn01_00116673 predicted 409
11 SASI_Rn01_00116674 predicted 1245
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323076 predicted 873
2 SASI_Rn02_00323077 predicted 600
3 SASI_Rn02_00323078 predicted 603
4 SASI_Rn02_00323079 predicted 401
5 SASI_Rn02_00323080 predicted 702
6 SASI_Rn02_00323081 predicted 329
7 SASI_Rn02_00323082 predicted 290
8 SASI_Rn02_00323083 predicted 519
9 SASI_Rn02_00323084 predicted 305
10 SASI_Rn02_00323085 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323275 predicted 605
2 SASI_Rn02_00323276 predicted 351
3 SASI_Rn02_00323277 predicted 1249
4 SASI_Rn02_00323278 predicted 1327
5 SASI_Rn02_00323279 predicted 1301
6 SASI_Rn02_00323280 predicted 462
7 SASI_Rn02_00323281 predicted 701
8 SASI_Rn02_00323282 predicted 353
9 SASI_Rn02_00323283 predicted 576
10 SASI_Rn02_00323284 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145571 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200970 predicted 785
2 SASI_Mm01_00200972 predicted 330
3 SASI_Mm01_00200971 predicted 911
4 SASI_Mm01_00200973 predicted 840
5 SASI_Mm02_00341085 predicted 933
6 SASI_Mm01_00200974 predicted 677
7 SASI_Mm01_00200975 predicted 398
8 SASI_Mm01_00200976 predicted 859
9 SASI_Mm01_00200977 predicted 874
10 SASI_Mm01_00200978 predicted 372
11 SASI_Mm01_00200979 predicted 935
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018221
VALIDATED
MOB1A MISSION shRNA Bacterial Glycerol Stock
MOB kinase activator 1A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018221.1-2102s1c1
Sequence:CCGGCCTCTATTTCTATTGGGATATCTCGAGATATCCCAATAGAAATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018221.1-725s1c1
Sequence:CCGGCCTCCTTTAAGCACTTTATTTCTCGAGAAATAAAGTGCTTAAAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018221.1-664s1c1
Sequence:CCGGCATATTTATCACCAGCACTTTCTCGAGAAAGTGCTGGTGATAAATATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018221.1-556s1c1
Sequence:CCGGCAGCTTGATGATGAAACTCTTCTCGAGAAGAGTTTCATCATCAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018221.1-651s1c1
Sequence:CCGGCAGGGTTTATGCCCATATTTACTCGAGTAAATATGGGCATAAACCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018221.3-767s21c1
Sequence:CCGGGGAGTTTAATCTGATTGATAGCTCGAGCTATCAATCAGATTAAACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018221.3-736s21c1
Sequence:CCGGCCTCCTTTAAGCACTTTATTTCTCGAGAAATAAAGTGCTTAAAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018221.3-567s21c1
Sequence:CCGGCAGCTTGATGATGAAACTCTTCTCGAGAAGAGTTTCATCATCAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018221.3-1109s21c1
Sequence:CCGGGGTTAACCTGTAGCTTATAAACTCGAGTTTATAAGCTACAGGTTAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_018221.3-482s21c1
Sequence:CCGGCTGGGCAGATGGTACTAATATCTCGAGATATTAGTACCATCTGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018221
VALIDATED
MOB1A MISSION shRNA shRNA Plasmid DNA
MOB kinase activator 1A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018221.1-2102s1c1
Sequence:CCGGCCTCTATTTCTATTGGGATATCTCGAGATATCCCAATAGAAATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018221.1-725s1c1
Sequence:CCGGCCTCCTTTAAGCACTTTATTTCTCGAGAAATAAAGTGCTTAAAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018221.1-664s1c1
Sequence:CCGGCATATTTATCACCAGCACTTTCTCGAGAAAGTGCTGGTGATAAATATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018221.1-556s1c1
Sequence:CCGGCAGCTTGATGATGAAACTCTTCTCGAGAAGAGTTTCATCATCAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018221.1-651s1c1
Sequence:CCGGCAGGGTTTATGCCCATATTTACTCGAGTAAATATGGGCATAAACCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018221.3-767s21c1
Sequence:CCGGGGAGTTTAATCTGATTGATAGCTCGAGCTATCAATCAGATTAAACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018221.3-736s21c1
Sequence:CCGGCCTCCTTTAAGCACTTTATTTCTCGAGAAATAAAGTGCTTAAAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018221.3-567s21c1
Sequence:CCGGCAGCTTGATGATGAAACTCTTCTCGAGAAGAGTTTCATCATCAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018221.3-1109s21c1
Sequence:CCGGGGTTAACCTGTAGCTTATAAACTCGAGTTTATAAGCTACAGGTTAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_018221.3-482s21c1
Sequence:CCGGCTGGGCAGATGGTACTAATATCTCGAGATATTAGTACCATCTGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018221
VALIDATED
MOB1A MISSION shRNA Lentiviral Transduction Particles
MOB kinase activator 1A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018221.1-2102s1c1
Sequence:CCGGCCTCTATTTCTATTGGGATATCTCGAGATATCCCAATAGAAATAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018221.1-725s1c1
Sequence:CCGGCCTCCTTTAAGCACTTTATTTCTCGAGAAATAAAGTGCTTAAAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018221.1-664s1c1
Sequence:CCGGCATATTTATCACCAGCACTTTCTCGAGAAAGTGCTGGTGATAAATATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018221.1-556s1c1
Sequence:CCGGCAGCTTGATGATGAAACTCTTCTCGAGAAGAGTTTCATCATCAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018221.1-651s1c1
Sequence:CCGGCAGGGTTTATGCCCATATTTACTCGAGTAAATATGGGCATAAACCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018221.3-767s21c1
Sequence:CCGGGGAGTTTAATCTGATTGATAGCTCGAGCTATCAATCAGATTAAACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018221.3-736s21c1
Sequence:CCGGCCTCCTTTAAGCACTTTATTTCTCGAGAAATAAAGTGCTTAAAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018221.3-567s21c1
Sequence:CCGGCAGCTTGATGATGAAACTCTTCTCGAGAAGAGTTTCATCATCAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018221.3-1109s21c1
Sequence:CCGGGGTTAACCTGTAGCTTATAAACTCGAGTTTATAAGCTACAGGTTAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_018221.3-482s21c1
Sequence:CCGGCTGGGCAGATGGTACTAATATCTCGAGATATTAGTACCATCTGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145571
VALIDATED
MOB1A MISSION shRNA Bacterial Glycerol Stock
MOB kinase activator 1A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145571.1-1112s1c1
Sequence:CCGGCCCATGACTAACCTGTAGTTTCTCGAGAAACTACAGGTTAGTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145571.1-845s1c1
Sequence:CCGGGCTTGGATCTAAAGACAGATACTCGAGTATCTGTCTTTAGATCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145571.1-819s1c1
Sequence:CCGGGCACCACTTCAGGAATTAATTCTCGAGAATTAATTCCTGAAGTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145571.1-679s1c1
Sequence:CCGGTCTTCAGGGTTTATGCCCATACTCGAGTATGGGCATAAACCCTGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145571.1-366s1c1
Sequence:CCGGGAGGACCTCAATGAATGGATTCTCGAGAATCCATTCATTGAGGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145571.2-366s21c1
Sequence:CCGGGAGGACCTCAATGAATGGATTCTCGAGAATCCATTCATTGAGGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145571.2-819s21c1
Sequence:CCGGGCACCACTTCAGGAATTAATTCTCGAGAATTAATTCCTGAAGTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145571.2-679s21c1
Sequence:CCGGTCTTCAGGGTTTATGCCCATACTCGAGTATGGGCATAAACCCTGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145571.2-845s21c1
Sequence:CCGGGCTTGGATCTAAAGACAGATACTCGAGTATCTGTCTTTAGATCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145571.2-1112s21c1
Sequence:CCGGCCCATGACTAACCTGTAGTTTCTCGAGAAACTACAGGTTAGTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145571
VALIDATED
MOB1A MISSION shRNA shRNA Plasmid DNA
MOB kinase activator 1A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145571.1-1112s1c1
Sequence:CCGGCCCATGACTAACCTGTAGTTTCTCGAGAAACTACAGGTTAGTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145571.1-845s1c1
Sequence:CCGGGCTTGGATCTAAAGACAGATACTCGAGTATCTGTCTTTAGATCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145571.1-819s1c1
Sequence:CCGGGCACCACTTCAGGAATTAATTCTCGAGAATTAATTCCTGAAGTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145571.1-679s1c1
Sequence:CCGGTCTTCAGGGTTTATGCCCATACTCGAGTATGGGCATAAACCCTGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145571.1-366s1c1
Sequence:CCGGGAGGACCTCAATGAATGGATTCTCGAGAATCCATTCATTGAGGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145571.2-366s21c1
Sequence:CCGGGAGGACCTCAATGAATGGATTCTCGAGAATCCATTCATTGAGGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145571.2-819s21c1
Sequence:CCGGGCACCACTTCAGGAATTAATTCTCGAGAATTAATTCCTGAAGTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145571.2-679s21c1
Sequence:CCGGTCTTCAGGGTTTATGCCCATACTCGAGTATGGGCATAAACCCTGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145571.2-845s21c1
Sequence:CCGGGCTTGGATCTAAAGACAGATACTCGAGTATCTGTCTTTAGATCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145571.2-1112s21c1
Sequence:CCGGCCCATGACTAACCTGTAGTTTCTCGAGAAACTACAGGTTAGTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145571
VALIDATED
MOB1A MISSION shRNA Lentiviral Transduction Particles
MOB kinase activator 1A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145571.1-1112s1c1
Sequence:CCGGCCCATGACTAACCTGTAGTTTCTCGAGAAACTACAGGTTAGTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145571.1-845s1c1
Sequence:CCGGGCTTGGATCTAAAGACAGATACTCGAGTATCTGTCTTTAGATCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145571.1-819s1c1
Sequence:CCGGGCACCACTTCAGGAATTAATTCTCGAGAATTAATTCCTGAAGTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145571.1-679s1c1
Sequence:CCGGTCTTCAGGGTTTATGCCCATACTCGAGTATGGGCATAAACCCTGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145571.1-366s1c1
Sequence:CCGGGAGGACCTCAATGAATGGATTCTCGAGAATCCATTCATTGAGGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145571.2-366s21c1
Sequence:CCGGGAGGACCTCAATGAATGGATTCTCGAGAATCCATTCATTGAGGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145571.2-819s21c1
Sequence:CCGGGCACCACTTCAGGAATTAATTCTCGAGAATTAATTCCTGAAGTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145571.2-679s21c1
Sequence:CCGGTCTTCAGGGTTTATGCCCATACTCGAGTATGGGCATAAACCCTGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145571.2-845s21c1
Sequence:CCGGGCTTGGATCTAAAGACAGATACTCGAGTATCTGTCTTTAGATCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145571.2-1112s21c1
Sequence:CCGGCCCATGACTAACCTGTAGTTTCTCGAGAAACTACAGGTTAGTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)