EMAIL THIS PAGE TO A FRIEND

MOB1B

MOB kinase activator 1B

164 Gene Product Result for
Synonyms: MATS2 MOB4A MOBKL1A
UniProtKB ID: Q7L9L4, B2R8U6, B4DRY3, Q8IY23
Gene ID:
Human(92597) Summary: The protein encoded by this gene is similar to the yeast Mob1 protein. Yeast Mob1 binds Mps1p, a protein kinase essential for spindle pole body duplication and mitotic checkpoint regulation. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(68473) MOB kinase activator 1B
Rat(360920) MOB kinase activator 1B
domestic cat(101084106) MOB kinase activator 1B
cow(515407) MOB kinase activator 1B
dog(482187) MOB kinase activator 1B
sheep(101123123) MOB kinase activator 1B
naked mole-rat(101721852) MOB kinase activator 1B
domestic guinea pig(100730622) MOB kinase activator 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026735 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026735 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026735 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173468 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_284098 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_284098 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_284098 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173468 Rosetta Predictions human pricing
NM_001108357 Rosetta Predictions rat pricing
NM_026735 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171109 predicted 1013
2 SASI_Hs01_00171110 predicted 516
3 SASI_Hs01_00171111 predicted 1035
4 SASI_Hs01_00171112 predicted 1050
5 SASI_Hs01_00171113 predicted 348
6 SASI_Hs01_00171114 predicted 362
7 SASI_Hs01_00171115 predicted 485
8 SASI_Hs01_00171116 predicted 400
9 SASI_Hs01_00171117 predicted 1114
10 SASI_Hs01_00171118 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108357 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237869 predicted 580
2 SASI_Rn02_00237870 predicted 410
3 SASI_Rn02_00237871 predicted 448
4 SASI_Rn02_00237872 predicted 890
5 SASI_Rn02_00237873 predicted 1324
6 SASI_Rn02_00237874 predicted 414
7 SASI_Rn02_00237875 predicted 954
8 SASI_Rn02_00237876 predicted 416
9 SASI_Rn02_00237877 predicted 1169
10 SASI_Rn02_00237878 predicted 955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026735 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163745 predicted 562
2 SASI_Mm01_00163746 predicted 1381
3 SASI_Mm01_00163747 predicted 691
4 SASI_Mm01_00163748 predicted 406
5 SASI_Mm01_00163749 predicted 1339
6 SASI_Mm01_00163750 predicted 890
7 SASI_Mm01_00163752 predicted 761
8 SASI_Mm01_00163753 predicted 1353
9 SASI_Mm01_00163754 predicted 815
10 SASI_Mm02_00330780 predicted 454
11 SASI_Mm01_00163751 predicted 594
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026735
VALIDATED
MOB1B MISSION shRNA Bacterial Glycerol Stock
MOB kinase activator 1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026735.2-613s21c1
Sequence:CCGGCTGGATGATGAGACATTATTTCTCGAGAAATAATGTCTCATCATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026735.2-844s21c1
Sequence:CCGGCCACTGCAAGAGCTGATTGAACTCGAGTTCAATCAGCTCTTGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026735.2-715s21c1
Sequence:CCGGGCTCATATTTATCACCAACATCTCGAGATGTTGGTGATAAATATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026735.2-648s21c1
Sequence:CCGGTGTTCCATTCCCGAAGAATTTCTCGAGAAATTCTTCGGGAATGGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026735.2-1181s21c1
Sequence:CCGGGCTGGAAACAAATGCGACAAACTCGAGTTTGTCGCATTTGTTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026735
VALIDATED
MOB1B MISSION shRNA shRNA Plasmid DNA
MOB kinase activator 1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026735.2-613s21c1
Sequence:CCGGCTGGATGATGAGACATTATTTCTCGAGAAATAATGTCTCATCATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026735.2-844s21c1
Sequence:CCGGCCACTGCAAGAGCTGATTGAACTCGAGTTCAATCAGCTCTTGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026735.2-715s21c1
Sequence:CCGGGCTCATATTTATCACCAACATCTCGAGATGTTGGTGATAAATATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026735.2-648s21c1
Sequence:CCGGTGTTCCATTCCCGAAGAATTTCTCGAGAAATTCTTCGGGAATGGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026735.2-1181s21c1
Sequence:CCGGGCTGGAAACAAATGCGACAAACTCGAGTTTGTCGCATTTGTTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026735
VALIDATED
MOB1B MISSION shRNA Lentiviral Transduction Particles
MOB kinase activator 1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026735.2-613s21c1
Sequence:CCGGCTGGATGATGAGACATTATTTCTCGAGAAATAATGTCTCATCATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026735.2-844s21c1
Sequence:CCGGCCACTGCAAGAGCTGATTGAACTCGAGTTCAATCAGCTCTTGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026735.2-715s21c1
Sequence:CCGGGCTCATATTTATCACCAACATCTCGAGATGTTGGTGATAAATATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026735.2-648s21c1
Sequence:CCGGTGTTCCATTCCCGAAGAATTTCTCGAGAAATTCTTCGGGAATGGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026735.2-1181s21c1
Sequence:CCGGGCTGGAAACAAATGCGACAAACTCGAGTTTGTCGCATTTGTTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173468
VALIDATED
MOB1B MISSION shRNA Bacterial Glycerol Stock
MOB kinase activator 1B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_173468.2-566s21c1
Sequence:CCGGTTGGATGATGAGACGTTATTTCTCGAGAAATAACGTCTCATCATCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_173468.2-1038s21c1
Sequence:CCGGTACACTTGATAAGGGTAAATTCTCGAGAATTTACCCTTATCAAGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173468.2-385s21c1
Sequence:CCGGCAATCAGATCAACATGCTTTACTCGAGTAAAGCATGTTGATCTGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173468.2-639s21c1
Sequence:CCGGCTATACTCAAACGCCTCTTTACTCGAGTAAAGAGGCGTTTGAGTATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_173468.2-985s21c1
Sequence:CCGGTGATTATGTGAAACCATATTCCTCGAGGAATATGGTTTCACATAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_173468.2-711s21c1
Sequence:CCGGAGGAGGAAGCACATCTAAATACTCGAGTATTTAGATGTGCTTCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173468.2-4141s1c1
Sequence:CCGGGCACTGTTTATTCCAGCTATACTCGAGTATAGCTGGAATAAACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_173468.2-604s1c1
Sequence:CCGGCCCGTTCCCAAAGAATTTCATCTCGAGATGAAATTCTTTGGGAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173468.2-385s1c1
Sequence:CCGGCAATCAGATCAACATGCTTTACTCGAGTAAAGCATGTTGATCTGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173468.2-798s1c1
Sequence:CCGGCACTCCAAGAACTGATTGAAACTCGAGTTTCAATCAGTTCTTGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173468.2-639s1c1
Sequence:CCGGCTATACTCAAACGCCTCTTTACTCGAGTAAAGAGGCGTTTGAGTATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173468
VALIDATED
MOB1B MISSION shRNA shRNA Plasmid DNA
MOB kinase activator 1B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_173468.2-566s21c1
Sequence:CCGGTTGGATGATGAGACGTTATTTCTCGAGAAATAACGTCTCATCATCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_173468.2-1038s21c1
Sequence:CCGGTACACTTGATAAGGGTAAATTCTCGAGAATTTACCCTTATCAAGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173468.2-385s21c1
Sequence:CCGGCAATCAGATCAACATGCTTTACTCGAGTAAAGCATGTTGATCTGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173468.2-639s21c1
Sequence:CCGGCTATACTCAAACGCCTCTTTACTCGAGTAAAGAGGCGTTTGAGTATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_173468.2-985s21c1
Sequence:CCGGTGATTATGTGAAACCATATTCCTCGAGGAATATGGTTTCACATAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_173468.2-711s21c1
Sequence:CCGGAGGAGGAAGCACATCTAAATACTCGAGTATTTAGATGTGCTTCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173468.2-4141s1c1
Sequence:CCGGGCACTGTTTATTCCAGCTATACTCGAGTATAGCTGGAATAAACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_173468.2-604s1c1
Sequence:CCGGCCCGTTCCCAAAGAATTTCATCTCGAGATGAAATTCTTTGGGAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173468.2-385s1c1
Sequence:CCGGCAATCAGATCAACATGCTTTACTCGAGTAAAGCATGTTGATCTGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173468.2-798s1c1
Sequence:CCGGCACTCCAAGAACTGATTGAAACTCGAGTTTCAATCAGTTCTTGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173468.2-639s1c1
Sequence:CCGGCTATACTCAAACGCCTCTTTACTCGAGTAAAGAGGCGTTTGAGTATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173468
VALIDATED
MOB1B MISSION shRNA Lentiviral Transduction Particles
MOB kinase activator 1B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_173468.2-566s21c1
Sequence:CCGGTTGGATGATGAGACGTTATTTCTCGAGAAATAACGTCTCATCATCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_173468.2-1038s21c1
Sequence:CCGGTACACTTGATAAGGGTAAATTCTCGAGAATTTACCCTTATCAAGTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173468.2-385s21c1
Sequence:CCGGCAATCAGATCAACATGCTTTACTCGAGTAAAGCATGTTGATCTGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173468.2-639s21c1
Sequence:CCGGCTATACTCAAACGCCTCTTTACTCGAGTAAAGAGGCGTTTGAGTATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_173468.2-985s21c1
Sequence:CCGGTGATTATGTGAAACCATATTCCTCGAGGAATATGGTTTCACATAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_173468.2-711s21c1
Sequence:CCGGAGGAGGAAGCACATCTAAATACTCGAGTATTTAGATGTGCTTCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173468.2-4141s1c1
Sequence:CCGGGCACTGTTTATTCCAGCTATACTCGAGTATAGCTGGAATAAACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_173468.2-604s1c1
Sequence:CCGGCCCGTTCCCAAAGAATTTCATCTCGAGATGAAATTCTTTGGGAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173468.2-385s1c1
Sequence:CCGGCAATCAGATCAACATGCTTTACTCGAGTAAAGCATGTTGATCTGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173468.2-798s1c1
Sequence:CCGGCACTCCAAGAACTGATTGAAACTCGAGTTTCAATCAGTTCTTGGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173468.2-639s1c1
Sequence:CCGGCTATACTCAAACGCCTCTTTACTCGAGTAAAGAGGCGTTTGAGTATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_284098
VALIDATED
MOB1B MISSION shRNA Bacterial Glycerol Stock
MOB kinase activator 1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_284098.3-1155s1c1
Sequence:CCGGGCTGGAAACAAATGCGACAAACTCGAGTTTGTCGCATTTGTTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284098.3-421s1c1
Sequence:CCGGGCTTTATGGAACCATCACAGACTCGAGTCTGTGATGGTTCCATAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_284098.3-818s1c1
Sequence:CCGGCCACTGCAAGAGCTGATTGAACTCGAGTTCAATCAGCTCTTGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_284098.3-622s1c1
Sequence:CCGGTGTTCCATTCCCGAAGAATTTCTCGAGAAATTCTTCGGGAATGGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_284098.3-689s1c1
Sequence:CCGGGCTCATATTTATCACCAACATCTCGAGATGTTGGTGATAAATATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_284098
VALIDATED
MOB1B MISSION shRNA shRNA Plasmid DNA
MOB kinase activator 1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_284098.3-1155s1c1
Sequence:CCGGGCTGGAAACAAATGCGACAAACTCGAGTTTGTCGCATTTGTTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284098.3-421s1c1
Sequence:CCGGGCTTTATGGAACCATCACAGACTCGAGTCTGTGATGGTTCCATAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_284098.3-818s1c1
Sequence:CCGGCCACTGCAAGAGCTGATTGAACTCGAGTTCAATCAGCTCTTGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_284098.3-622s1c1
Sequence:CCGGTGTTCCATTCCCGAAGAATTTCTCGAGAAATTCTTCGGGAATGGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_284098.3-689s1c1
Sequence:CCGGGCTCATATTTATCACCAACATCTCGAGATGTTGGTGATAAATATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_284098
VALIDATED
MOB1B MISSION shRNA Lentiviral Transduction Particles
MOB kinase activator 1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_284098.3-1155s1c1
Sequence:CCGGGCTGGAAACAAATGCGACAAACTCGAGTTTGTCGCATTTGTTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284098.3-421s1c1
Sequence:CCGGGCTTTATGGAACCATCACAGACTCGAGTCTGTGATGGTTCCATAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_284098.3-818s1c1
Sequence:CCGGCCACTGCAAGAGCTGATTGAACTCGAGTTCAATCAGCTCTTGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_284098.3-622s1c1
Sequence:CCGGTGTTCCATTCCCGAAGAATTTCTCGAGAAATTCTTCGGGAATGGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_284098.3-689s1c1
Sequence:CCGGGCTCATATTTATCACCAACATCTCGAGATGTTGGTGATAAATATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)