EMAIL THIS PAGE TO A FRIEND

MOB2

MOB kinase activator 2

52 Gene Product Result for
Synonyms: HCCA2
UniProtKB ID: Q70IA6, B4DKP3, Q96M67
Gene ID:
Mouse(101513) MOB kinase activator 2
Rat(499288) MOB kinase activator 2
fruit fly(39293) CG11711 gene product from transcript CG11711-RA
chicken(423097) MOB kinase activator 2
domestic cat(101095857) MOB kinase activator 2
cow(789811) MOB kinase activator 2
dog(611494) MOB kinase activator 2
domestic guinea pig(100731269) MOB kinase activator 2
naked mole-rat(101716857) MOB kinase activator 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028308 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028308 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028308 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_053005 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053005 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053005 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053005 Rosetta Predictions human pricing
NM_001109159 Rosetta Predictions rat pricing
NM_028308 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177399 predicted 623
2 SASI_Hs01_00177400 predicted 942
3 SASI_Hs01_00177401 predicted 560
4 SASI_Hs01_00177402 predicted 965
5 SASI_Hs01_00177403 predicted 353
6 SASI_Hs01_00177404 predicted 276
7 SASI_Hs02_00361836 predicted 588
8 SASI_Hs01_00177405 predicted 943
9 SASI_Hs01_00177406 predicted 281
10 SASI_Hs01_00177407 predicted 1218
11 SASI_Hs01_00177408 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109159 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245710 predicted 653
2 SASI_Rn02_00245711 predicted 553
3 SASI_Rn02_00245712 predicted 471
4 SASI_Rn02_00245713 predicted 910
5 SASI_Rn02_00245714 predicted 293
6 SASI_Rn02_00245715 predicted 843
7 SASI_Rn02_00245716 predicted 276
8 SASI_Rn02_00245717 predicted 956
9 SASI_Rn02_00245718 predicted 221
10 SASI_Rn02_00245719 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153981 predicted 661
2 SASI_Mm01_00153982 predicted 616
3 SASI_Mm01_00153983 predicted 555
4 SASI_Mm01_00153984 predicted 300
5 SASI_Mm01_00153985 predicted 466
6 SASI_Mm01_00153986 predicted 913
7 SASI_Mm01_00153987 predicted 840
8 SASI_Mm01_00153988 predicted 935
9 SASI_Mm01_00153989 predicted 690
10 SASI_Mm02_00333666 predicted 721
11 SASI_Mm01_00153980 predicted 752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028308
MOB2 MISSION shRNA Bacterial Glycerol Stock
MOB kinase activator 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028308.1-1074s1c1
Sequence:CCGGCGGCTTTGAAAGGAGCACCTTCTCGAGAAGGTGCTCCTTTCAAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028308.1-243s1c1
Sequence:CCGGGTATAGCACAATCTCAGAATTCTCGAGAATTCTGAGATTGTGCTATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028308.1-131s1c1
Sequence:CCGGCCAGGATCACTGACTTTGAATCTCGAGATTCAAAGTCAGTGATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028308.1-61s1c1
Sequence:CCGGGCTAAGCCAAACGGCAAGAAACTCGAGTTTCTTGCCGTTTGGCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028308.1-240s1c1
Sequence:CCGGGCAGTATAGCACAATCTCAGACTCGAGTCTGAGATTGTGCTATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028308.2-938s21c1
Sequence:CCGGAGCCTTTGGAGTCATTCATTCCTCGAGGAATGAATGACTCCAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028308.2-243s21c1
Sequence:CCGGGTATAGCACAATCTCAGAATTCTCGAGAATTCTGAGATTGTGCTATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028308.2-470s21c1
Sequence:CCGGAGATCTGCAAGTATCTGTTTCCTCGAGGAAACAGATACTTGCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028308.2-558s21c1
Sequence:CCGGGAACACACTGTACGTGCATTTCTCGAGAAATGCACGTACAGTGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028308.2-62s21c1
Sequence:CCGGCTAAGCCAAACGGCAAGAAACCTCGAGGTTTCTTGCCGTTTGGCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028308
MOB2 MISSION shRNA shRNA Plasmid DNA
MOB kinase activator 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028308.1-1074s1c1
Sequence:CCGGCGGCTTTGAAAGGAGCACCTTCTCGAGAAGGTGCTCCTTTCAAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028308.1-243s1c1
Sequence:CCGGGTATAGCACAATCTCAGAATTCTCGAGAATTCTGAGATTGTGCTATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028308.1-131s1c1
Sequence:CCGGCCAGGATCACTGACTTTGAATCTCGAGATTCAAAGTCAGTGATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028308.1-61s1c1
Sequence:CCGGGCTAAGCCAAACGGCAAGAAACTCGAGTTTCTTGCCGTTTGGCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028308.1-240s1c1
Sequence:CCGGGCAGTATAGCACAATCTCAGACTCGAGTCTGAGATTGTGCTATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028308.2-938s21c1
Sequence:CCGGAGCCTTTGGAGTCATTCATTCCTCGAGGAATGAATGACTCCAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028308.2-243s21c1
Sequence:CCGGGTATAGCACAATCTCAGAATTCTCGAGAATTCTGAGATTGTGCTATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028308.2-470s21c1
Sequence:CCGGAGATCTGCAAGTATCTGTTTCCTCGAGGAAACAGATACTTGCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028308.2-558s21c1
Sequence:CCGGGAACACACTGTACGTGCATTTCTCGAGAAATGCACGTACAGTGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028308.2-62s21c1
Sequence:CCGGCTAAGCCAAACGGCAAGAAACCTCGAGGTTTCTTGCCGTTTGGCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028308
MOB2 MISSION shRNA Lentiviral Transduction Particles
MOB kinase activator 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028308.1-1074s1c1
Sequence:CCGGCGGCTTTGAAAGGAGCACCTTCTCGAGAAGGTGCTCCTTTCAAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028308.1-243s1c1
Sequence:CCGGGTATAGCACAATCTCAGAATTCTCGAGAATTCTGAGATTGTGCTATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028308.1-131s1c1
Sequence:CCGGCCAGGATCACTGACTTTGAATCTCGAGATTCAAAGTCAGTGATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028308.1-61s1c1
Sequence:CCGGGCTAAGCCAAACGGCAAGAAACTCGAGTTTCTTGCCGTTTGGCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028308.1-240s1c1
Sequence:CCGGGCAGTATAGCACAATCTCAGACTCGAGTCTGAGATTGTGCTATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028308.2-938s21c1
Sequence:CCGGAGCCTTTGGAGTCATTCATTCCTCGAGGAATGAATGACTCCAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028308.2-243s21c1
Sequence:CCGGGTATAGCACAATCTCAGAATTCTCGAGAATTCTGAGATTGTGCTATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028308.2-470s21c1
Sequence:CCGGAGATCTGCAAGTATCTGTTTCCTCGAGGAAACAGATACTTGCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028308.2-558s21c1
Sequence:CCGGGAACACACTGTACGTGCATTTCTCGAGAAATGCACGTACAGTGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028308.2-62s21c1
Sequence:CCGGCTAAGCCAAACGGCAAGAAACCTCGAGGTTTCTTGCCGTTTGGCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053005
MOB2 MISSION shRNA Bacterial Glycerol Stock
MOB kinase activator 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053005.2-365s1c1
Sequence:CCGGCAGTACGTTGACTTCGTCATGCTCGAGCATGACGAAGTCAACGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053005.2-301s1c1
Sequence:CCGGCGTGTGCAACACACAGTACTACTCGAGTAGTACTGTGTGTTGCACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053005.2-183s1c1
Sequence:CCGGGCGAGATTGACCTTAACGAGTCTCGAGACTCGTTAAGGTCAATCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053005.2-142s1c1
Sequence:CCGGGATCACCGACTTCCAGTTCAACTCGAGTTGAACTGGAAGTCGGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053005.2-187s1c1
Sequence:CCGGGATTGACCTTAACGAGTGGCTCTCGAGAGCCACTCGTTAAGGTCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053005.2-957s1c1
Sequence:CCGGCGTTTGTAGAGAAGAGCCTTTCTCGAGAAAGGCTCTTCTCTACAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053005.2-475s1c1
Sequence:CCGGGAAGATCTGCAGACACCTGTTCTCGAGAACAGGTGTCTGCAGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053005
MOB2 MISSION shRNA shRNA Plasmid DNA
MOB kinase activator 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053005.2-365s1c1
Sequence:CCGGCAGTACGTTGACTTCGTCATGCTCGAGCATGACGAAGTCAACGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053005.2-301s1c1
Sequence:CCGGCGTGTGCAACACACAGTACTACTCGAGTAGTACTGTGTGTTGCACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053005.2-183s1c1
Sequence:CCGGGCGAGATTGACCTTAACGAGTCTCGAGACTCGTTAAGGTCAATCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053005.2-142s1c1
Sequence:CCGGGATCACCGACTTCCAGTTCAACTCGAGTTGAACTGGAAGTCGGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053005.2-187s1c1
Sequence:CCGGGATTGACCTTAACGAGTGGCTCTCGAGAGCCACTCGTTAAGGTCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053005.2-957s1c1
Sequence:CCGGCGTTTGTAGAGAAGAGCCTTTCTCGAGAAAGGCTCTTCTCTACAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053005.2-475s1c1
Sequence:CCGGGAAGATCTGCAGACACCTGTTCTCGAGAACAGGTGTCTGCAGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053005
MOB2 MISSION shRNA Lentiviral Transduction Particles
MOB kinase activator 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053005.2-365s1c1
Sequence:CCGGCAGTACGTTGACTTCGTCATGCTCGAGCATGACGAAGTCAACGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053005.2-301s1c1
Sequence:CCGGCGTGTGCAACACACAGTACTACTCGAGTAGTACTGTGTGTTGCACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053005.2-183s1c1
Sequence:CCGGGCGAGATTGACCTTAACGAGTCTCGAGACTCGTTAAGGTCAATCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053005.2-142s1c1
Sequence:CCGGGATCACCGACTTCCAGTTCAACTCGAGTTGAACTGGAAGTCGGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053005.2-187s1c1
Sequence:CCGGGATTGACCTTAACGAGTGGCTCTCGAGAGCCACTCGTTAAGGTCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053005.2-957s1c1
Sequence:CCGGCGTTTGTAGAGAAGAGCCTTTCTCGAGAAAGGCTCTTCTCTACAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053005.2-475s1c1
Sequence:CCGGGAAGATCTGCAGACACCTGTTCTCGAGAACAGGTGTCTGCAGATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)