EMAIL THIS PAGE TO A FRIEND

MOB3B

MOB kinase activator 3B

226 Gene Product Result for
Synonyms: C9orf35 MOB1D MOBKL2B
UniProtKB ID: Q86TA1, Q8NEB4, Q9H8V4
Gene ID:
Human(79817) Summary: The protein encoded by this gene shares similarity with the yeast Mob1 protein. Yeast Mob1 binds Mps1p, a protein kinase essential for spindle pole body duplication and mitotic checkpoint regulation. This gene is located on the opposite strand as the interferon kappa precursor (IFNK) gene. [provided by RefSeq, Jul 2008]
Mouse(214944) MOB kinase activator 3B
Rat(366352) MOB kinase activator 3B
domestic guinea pig(100713881) MOB kinase activator 3B
naked mole-rat(101711098) MOB kinase activator 3B
sheep(101111255) MOB kinase activator 3B
domestic cat(101094300) MOB kinase activator 3B
cow(540817) MOB kinase activator 3B
dog(474735) MOB kinase activator 3B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178061 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178061 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178061 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024761 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024761 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024761 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024761 Rosetta Predictions human pricing
NM_001108970 Rosetta Predictions rat pricing
NM_178061 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185712 predicted 844
2 SASI_Hs01_00185714 predicted 1492
3 SASI_Hs01_00185715 predicted 1059
4 SASI_Hs01_00185716 predicted 1467
5 SASI_Hs01_00185717 predicted 668
6 SASI_Hs01_00185718 predicted 571
7 SASI_Hs01_00185719 predicted 656
8 SASI_Hs02_00357262 predicted 1292
9 SASI_Hs01_00185721 predicted 522
10 SASI_Hs02_00357263 predicted 862
11 SASI_Hs01_00185713 predicted 973
12 SASI_Hs01_00185720 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243884 predicted 966
2 SASI_Rn02_00243885 predicted 787
3 SASI_Rn02_00243886 predicted 492
4 SASI_Rn02_00243887 predicted 973
5 SASI_Rn02_00243888 predicted 804
6 SASI_Rn02_00243889 predicted 1274
7 SASI_Rn02_00243890 predicted 628
8 SASI_Rn02_00243891 predicted 1205
9 SASI_Rn02_00243892 predicted 446
10 SASI_Rn02_00243893 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178061 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020487 predicted 808
2 SASI_Mm01_00020488 predicted 964
3 SASI_Mm01_00020489 predicted 786
4 SASI_Mm02_00348520 predicted 1372
5 SASI_Mm02_00348521 predicted 490
6 SASI_Mm02_00348522 predicted 1450
7 SASI_Mm02_00348523 predicted 1487
8 SASI_Mm01_00020490 predicted 1278
9 SASI_Mm02_00348524 predicted 980
10 SASI_Mm02_00348525 predicted 1061
11 SASI_Mm01_00020486 predicted 492
12 SASI_Mm01_00020491 predicted 481
13 SASI_Mm01_00020492 predicted 1067
14 SASI_Mm01_00020493 predicted 803
15 SASI_Mm01_00020494 predicted 1155
16 SASI_Mm01_00020495 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178061
VALIDATED
MOB3B MISSION shRNA Bacterial Glycerol Stock
MOB kinase activator 3B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178061.3-2116s1c1
Sequence:CCGGCCGTACTATATGACACAGAATCTCGAGATTCTGTGTCATATAGTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178061.3-919s1c1
Sequence:CCGGCATCACTTTGACCGTGTCATTCTCGAGAATGACACGGTCAAAGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178061.3-695s1c1
Sequence:CCGGGCCCGAAATACGAGTACCGATCTCGAGATCGGTACTCGTATTTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178061.3-918s1c1
Sequence:CCGGTCATCACTTTGACCGTGTCATCTCGAGATGACACGGTCAAAGTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178061.3-762s1c1
Sequence:CCGGCCAGTACATGAATCTGCTTATCTCGAGATAAGCAGATTCATGTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178061.4-1452s21c1
Sequence:CCGGTAACTTCTCTGTCACTTATTTCTCGAGAAATAAGTGACAGAGAAGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178061.4-717s21c1
Sequence:CCGGGCAGGATGACCTCAAGTATAACTCGAGTTATACTTGAGGTCATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178061.4-1488s21c1
Sequence:CCGGCAAACGTGGAGCTACCATATACTCGAGTATATGGTAGCTCCACGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178061.4-611s21c1
Sequence:CCGGTGGACTTCTTCAATCGCATTACTCGAGTAATGCGATTGAAGAAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178061
VALIDATED
MOB3B MISSION shRNA shRNA Plasmid DNA
MOB kinase activator 3B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178061.3-2116s1c1
Sequence:CCGGCCGTACTATATGACACAGAATCTCGAGATTCTGTGTCATATAGTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178061.3-919s1c1
Sequence:CCGGCATCACTTTGACCGTGTCATTCTCGAGAATGACACGGTCAAAGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178061.3-695s1c1
Sequence:CCGGGCCCGAAATACGAGTACCGATCTCGAGATCGGTACTCGTATTTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178061.3-918s1c1
Sequence:CCGGTCATCACTTTGACCGTGTCATCTCGAGATGACACGGTCAAAGTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178061.3-762s1c1
Sequence:CCGGCCAGTACATGAATCTGCTTATCTCGAGATAAGCAGATTCATGTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178061.4-1452s21c1
Sequence:CCGGTAACTTCTCTGTCACTTATTTCTCGAGAAATAAGTGACAGAGAAGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178061.4-717s21c1
Sequence:CCGGGCAGGATGACCTCAAGTATAACTCGAGTTATACTTGAGGTCATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178061.4-1488s21c1
Sequence:CCGGCAAACGTGGAGCTACCATATACTCGAGTATATGGTAGCTCCACGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178061.4-611s21c1
Sequence:CCGGTGGACTTCTTCAATCGCATTACTCGAGTAATGCGATTGAAGAAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178061
VALIDATED
MOB3B MISSION shRNA Lentiviral Transduction Particles
MOB kinase activator 3B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178061.3-2116s1c1
Sequence:CCGGCCGTACTATATGACACAGAATCTCGAGATTCTGTGTCATATAGTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178061.3-919s1c1
Sequence:CCGGCATCACTTTGACCGTGTCATTCTCGAGAATGACACGGTCAAAGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178061.3-695s1c1
Sequence:CCGGGCCCGAAATACGAGTACCGATCTCGAGATCGGTACTCGTATTTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178061.3-918s1c1
Sequence:CCGGTCATCACTTTGACCGTGTCATCTCGAGATGACACGGTCAAAGTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178061.3-762s1c1
Sequence:CCGGCCAGTACATGAATCTGCTTATCTCGAGATAAGCAGATTCATGTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178061.4-1452s21c1
Sequence:CCGGTAACTTCTCTGTCACTTATTTCTCGAGAAATAAGTGACAGAGAAGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178061.4-717s21c1
Sequence:CCGGGCAGGATGACCTCAAGTATAACTCGAGTTATACTTGAGGTCATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178061.4-1488s21c1
Sequence:CCGGCAAACGTGGAGCTACCATATACTCGAGTATATGGTAGCTCCACGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178061.4-611s21c1
Sequence:CCGGTGGACTTCTTCAATCGCATTACTCGAGTAATGCGATTGAAGAAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024761
VALIDATED
MOB3B MISSION shRNA Bacterial Glycerol Stock
MOB kinase activator 3B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_024761.3-572s1c1
Sequence:CCGGCAGAGGTTTGAGCTGCACAAACTCGAGTTTGTGCAGCTCAAACCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024761.3-878s1c1
Sequence:CCGGCAGATCAACAACGAGGAAATACTCGAGTATTTCCTCGTTGTTGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024761.3-1117s1c1
Sequence:CCGGGAAAGAAATGACGAGCAGGATCTCGAGATCCTGCTCGTCATTTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024761.3-796s1c1
Sequence:CCGGGCAGGATGATCTCAAGTATAACTCGAGTTATACTTGAGATCATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024761.3-900s21c1
Sequence:CCGGTTCCAACATGCGTGGGTGTTCCTCGAGGAACACCCACGCATGTTGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024761.3-1053s21c1
Sequence:CCGGACAAACACTTCTATTACTTTGCTCGAGCAAAGTAATAGAAGTGTTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024761.3-842s21c1
Sequence:CCGGCAGTACATGAACCTTCTTATGCTCGAGCATAAGAAGGTTCATGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024761.3-678s21c1
Sequence:CCGGCAGTACATGTGGTGGACTTCTCTCGAGAGAAGTCCACCACATGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024761.3-1076s21c1
Sequence:CCGGACAGAGATGAACCTCATAGACCTCGAGGTCTATGAGGTTCATCTCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024761.3-1499s21c1
Sequence:CCGGCTGAGATGCGTGTTCGTATTTCTCGAGAAATACGAACACGCATCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024761
VALIDATED
MOB3B MISSION shRNA shRNA Plasmid DNA
MOB kinase activator 3B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_024761.3-572s1c1
Sequence:CCGGCAGAGGTTTGAGCTGCACAAACTCGAGTTTGTGCAGCTCAAACCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024761.3-878s1c1
Sequence:CCGGCAGATCAACAACGAGGAAATACTCGAGTATTTCCTCGTTGTTGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024761.3-1117s1c1
Sequence:CCGGGAAAGAAATGACGAGCAGGATCTCGAGATCCTGCTCGTCATTTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024761.3-796s1c1
Sequence:CCGGGCAGGATGATCTCAAGTATAACTCGAGTTATACTTGAGATCATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024761.3-900s21c1
Sequence:CCGGTTCCAACATGCGTGGGTGTTCCTCGAGGAACACCCACGCATGTTGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024761.3-1053s21c1
Sequence:CCGGACAAACACTTCTATTACTTTGCTCGAGCAAAGTAATAGAAGTGTTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024761.3-842s21c1
Sequence:CCGGCAGTACATGAACCTTCTTATGCTCGAGCATAAGAAGGTTCATGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024761.3-678s21c1
Sequence:CCGGCAGTACATGTGGTGGACTTCTCTCGAGAGAAGTCCACCACATGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024761.3-1076s21c1
Sequence:CCGGACAGAGATGAACCTCATAGACCTCGAGGTCTATGAGGTTCATCTCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024761.3-1499s21c1
Sequence:CCGGCTGAGATGCGTGTTCGTATTTCTCGAGAAATACGAACACGCATCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024761
VALIDATED
MOB3B MISSION shRNA Lentiviral Transduction Particles
MOB kinase activator 3B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_024761.3-572s1c1
Sequence:CCGGCAGAGGTTTGAGCTGCACAAACTCGAGTTTGTGCAGCTCAAACCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024761.3-878s1c1
Sequence:CCGGCAGATCAACAACGAGGAAATACTCGAGTATTTCCTCGTTGTTGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024761.3-1117s1c1
Sequence:CCGGGAAAGAAATGACGAGCAGGATCTCGAGATCCTGCTCGTCATTTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024761.3-796s1c1
Sequence:CCGGGCAGGATGATCTCAAGTATAACTCGAGTTATACTTGAGATCATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024761.3-900s21c1
Sequence:CCGGTTCCAACATGCGTGGGTGTTCCTCGAGGAACACCCACGCATGTTGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024761.3-1053s21c1
Sequence:CCGGACAAACACTTCTATTACTTTGCTCGAGCAAAGTAATAGAAGTGTTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024761.3-842s21c1
Sequence:CCGGCAGTACATGAACCTTCTTATGCTCGAGCATAAGAAGGTTCATGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024761.3-678s21c1
Sequence:CCGGCAGTACATGTGGTGGACTTCTCTCGAGAGAAGTCCACCACATGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024761.3-1076s21c1
Sequence:CCGGACAGAGATGAACCTCATAGACCTCGAGGTCTATGAGGTTCATCTCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024761.3-1499s21c1
Sequence:CCGGCTGAGATGCGTGTTCGTATTTCTCGAGAAATACGAACACGCATCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)