EMAIL THIS PAGE TO A FRIEND

MOB3C

MOB kinase activator 3C

76 Gene Product Result for
Synonyms: MOB1E MOBKL2C
Gene ID:
Human(148932) Summary: The protein encoded by this gene is similar to the yeast Mob1 protein. Yeast Mob1 binds Mps1p, a protein kinase essential for spindle pole body duplication and mitotic checkpoint regulation. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(100465) MOB kinase activator 3C
Rat(313511) MOB kinase activator 3C
Zebrafish(431738) MOB kinase activator 3C
cow(614275) MOB kinase activator 3C
domestic cat(101082764) MOB kinase activator 3C
dog(482508) MOB kinase activator 3C
sheep(101104355) MOB kinase activator 3C
naked mole-rat(101723136) MOB kinase activator 3C
domestic guinea pig(100731151) MOB kinase activator 3C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145279 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175308 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175308 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175308 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145279 Rosetta Predictions human pricing
NM_201403 Rosetta Predictions human pricing
NM_001107960 Rosetta Predictions rat pricing
NM_175308 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177349 predicted 883
2 SASI_Hs01_00177350 predicted 558
3 SASI_Hs01_00177351 predicted 541
4 SASI_Hs01_00177352 predicted 935
5 SASI_Hs01_00177353 predicted 631
6 SASI_Hs01_00177354 predicted 581
7 SASI_Hs01_00177355 predicted 886
8 SASI_Hs02_00365155 predicted 822
9 SASI_Hs01_00177356 predicted 432
10 SASI_Hs01_00177357 predicted 665
11 SASI_Hs01_00177358 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156901 predicted 895
2 SASI_Hs01_00156902 predicted 570
3 SASI_Hs01_00156903 predicted 560
4 SASI_Hs01_00156904 predicted 958
5 SASI_Hs01_00156905 predicted 643
6 SASI_Hs01_00156906 predicted 600
7 SASI_Hs01_00156907 predicted 909
8 SASI_Hs02_00372944 predicted 847
9 SASI_Hs01_00156908 predicted 456
10 SASI_Hs01_00156909 predicted 681
11 SASI_Hs01_00156910 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233985 predicted 356
2 SASI_Rn02_00233986 predicted 589
3 SASI_Rn02_00233987 predicted 387
4 SASI_Rn02_00233988 predicted 548
5 SASI_Rn02_00233989 predicted 655
6 SASI_Rn02_00233990 predicted 572
7 SASI_Rn02_00233991 predicted 394
8 SASI_Rn02_00233992 predicted 569
9 SASI_Rn02_00233993 predicted 384
10 SASI_Rn02_00233994 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346065 predicted 535
2 SASI_Mm02_00346066 predicted 194
3 SASI_Mm02_00346067 predicted 272
4 SASI_Mm02_00346068 predicted 907
5 SASI_Mm02_00346069 predicted 812
6 SASI_Mm02_00346070 predicted 646
7 SASI_Mm02_00346071 predicted 827
8 SASI_Mm02_00346072 predicted 445
9 SASI_Mm02_00346073 predicted 737
10 SASI_Mm02_00346074 predicted 384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145279
VALIDATED
MOB3C MISSION shRNA Bacterial Glycerol Stock
MOB kinase activator 3C
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145279.4-113s21c1
Sequence:CCGGTTTGGGTGAGAAGTCGAAGAGCTCGAGCTCTTCGACTTCTCACCCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145279.4-373s21c1
Sequence:CCGGGAGAACATCGACGACTGGATCCTCGAGGATCCAGTCGTCGATGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145279.4-131s21c1
Sequence:CCGGGAGTCGGGATGGATGAGATGACTCGAGTCATCTCATCCATCCCGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145279.4-409s21c1
Sequence:CCGGGACTTCTTCAACCGCATCAACCTCGAGGTTGATGCGGTTGAAGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145279.4-616s21c1
Sequence:CCGGTTTCCCACGCGTGTTGGAGTTCTCGAGAACTCCAACACGCGTGGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145279.4-1161s21c1
Sequence:CCGGTGCTGGTTCCCAAGCCTATTGCTCGAGCAATAGGCTTGGGAACCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145279.4-585s21c1
Sequence:CCGGGATCGAAGGCCTCATCAACGACTCGAGTCGTTGATGAGGCCTTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_145279.3-2192s1c1
Sequence:CCGGCCTGAGAATCATCCAGTCTTACTCGAGTAAGACTGGATGATTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145279.3-558s1c1
Sequence:CCGGGCGCTATATGGCATTGCTCATCTCGAGATGAGCAATGCCATATAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_145279.3-780s1c1
Sequence:CCGGCTACTACTTCATCCGCGAGTTCTCGAGAACTCGCGGATGAAGTAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_145279.3-147s1c1
Sequence:CCGGGATGACCTTTCACATCTGGTACTCGAGTACCAGATGTGAAAGGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_145279.3-720s1c1
Sequence:CCGGCTTCGATAGCATCCTCAGCATCTCGAGATGCTGAGGATGCTATCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145279
VALIDATED
MOB3C MISSION shRNA shRNA Plasmid DNA
MOB kinase activator 3C
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145279.4-113s21c1
Sequence:CCGGTTTGGGTGAGAAGTCGAAGAGCTCGAGCTCTTCGACTTCTCACCCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145279.4-373s21c1
Sequence:CCGGGAGAACATCGACGACTGGATCCTCGAGGATCCAGTCGTCGATGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145279.4-131s21c1
Sequence:CCGGGAGTCGGGATGGATGAGATGACTCGAGTCATCTCATCCATCCCGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145279.4-409s21c1
Sequence:CCGGGACTTCTTCAACCGCATCAACCTCGAGGTTGATGCGGTTGAAGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145279.4-616s21c1
Sequence:CCGGTTTCCCACGCGTGTTGGAGTTCTCGAGAACTCCAACACGCGTGGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145279.4-1161s21c1
Sequence:CCGGTGCTGGTTCCCAAGCCTATTGCTCGAGCAATAGGCTTGGGAACCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145279.4-585s21c1
Sequence:CCGGGATCGAAGGCCTCATCAACGACTCGAGTCGTTGATGAGGCCTTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_145279.3-2192s1c1
Sequence:CCGGCCTGAGAATCATCCAGTCTTACTCGAGTAAGACTGGATGATTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145279.3-558s1c1
Sequence:CCGGGCGCTATATGGCATTGCTCATCTCGAGATGAGCAATGCCATATAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_145279.3-780s1c1
Sequence:CCGGCTACTACTTCATCCGCGAGTTCTCGAGAACTCGCGGATGAAGTAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_145279.3-147s1c1
Sequence:CCGGGATGACCTTTCACATCTGGTACTCGAGTACCAGATGTGAAAGGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_145279.3-720s1c1
Sequence:CCGGCTTCGATAGCATCCTCAGCATCTCGAGATGCTGAGGATGCTATCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145279
VALIDATED
MOB3C MISSION shRNA Lentiviral Transduction Particles
MOB kinase activator 3C
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145279.4-113s21c1
Sequence:CCGGTTTGGGTGAGAAGTCGAAGAGCTCGAGCTCTTCGACTTCTCACCCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145279.4-373s21c1
Sequence:CCGGGAGAACATCGACGACTGGATCCTCGAGGATCCAGTCGTCGATGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145279.4-131s21c1
Sequence:CCGGGAGTCGGGATGGATGAGATGACTCGAGTCATCTCATCCATCCCGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145279.4-409s21c1
Sequence:CCGGGACTTCTTCAACCGCATCAACCTCGAGGTTGATGCGGTTGAAGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145279.4-616s21c1
Sequence:CCGGTTTCCCACGCGTGTTGGAGTTCTCGAGAACTCCAACACGCGTGGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145279.4-1161s21c1
Sequence:CCGGTGCTGGTTCCCAAGCCTATTGCTCGAGCAATAGGCTTGGGAACCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145279.4-585s21c1
Sequence:CCGGGATCGAAGGCCTCATCAACGACTCGAGTCGTTGATGAGGCCTTCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_145279.3-2192s1c1
Sequence:CCGGCCTGAGAATCATCCAGTCTTACTCGAGTAAGACTGGATGATTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145279.3-558s1c1
Sequence:CCGGGCGCTATATGGCATTGCTCATCTCGAGATGAGCAATGCCATATAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_145279.3-780s1c1
Sequence:CCGGCTACTACTTCATCCGCGAGTTCTCGAGAACTCGCGGATGAAGTAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_145279.3-147s1c1
Sequence:CCGGGATGACCTTTCACATCTGGTACTCGAGTACCAGATGTGAAAGGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_145279.3-720s1c1
Sequence:CCGGCTTCGATAGCATCCTCAGCATCTCGAGATGCTGAGGATGCTATCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175308
MOB3C MISSION shRNA Bacterial Glycerol Stock
MOB kinase activator 3C
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175308.4-1349s21c1
Sequence:CCGGTGGATAGATGATGGATGTATACTCGAGTATACATCCATCATCTATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175308.4-274s21c1
Sequence:CCGGACAGCGCTTTGAGCTATATAACTCGAGTTATATAGCTCAAAGCGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175308.4-405s21c1
Sequence:CCGGACCGTATCAACCTCATCTATGCTCGAGCATAGATGAGGTTGATACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175308.2-1336s1c1
Sequence:CCGGGCTCTCATTATGGATGGATATCTCGAGATATCCATCCATAATGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175308.2-545s1c1
Sequence:CCGGCCGCTATATGGCATTGCTCATCTCGAGATGAGCAATGCCATATAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175308.2-738s1c1
Sequence:CCGGGCACATGTCAACACCTGCTATCTCGAGATAGCAGGTGTTGACATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175308.2-285s1c1
Sequence:CCGGGAGCTATATAAGAAGGCACAACTCGAGTTGTGCCTTCTTATATAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175308.2-825s1c1
Sequence:CCGGGAGATGACAGAACGGATCTGTCTCGAGACAGATCCGTTCTGTCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175308
MOB3C MISSION shRNA shRNA Plasmid DNA
MOB kinase activator 3C
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175308.4-1349s21c1
Sequence:CCGGTGGATAGATGATGGATGTATACTCGAGTATACATCCATCATCTATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175308.4-274s21c1
Sequence:CCGGACAGCGCTTTGAGCTATATAACTCGAGTTATATAGCTCAAAGCGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175308.4-405s21c1
Sequence:CCGGACCGTATCAACCTCATCTATGCTCGAGCATAGATGAGGTTGATACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175308.2-1336s1c1
Sequence:CCGGGCTCTCATTATGGATGGATATCTCGAGATATCCATCCATAATGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175308.2-545s1c1
Sequence:CCGGCCGCTATATGGCATTGCTCATCTCGAGATGAGCAATGCCATATAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175308.2-738s1c1
Sequence:CCGGGCACATGTCAACACCTGCTATCTCGAGATAGCAGGTGTTGACATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175308.2-285s1c1
Sequence:CCGGGAGCTATATAAGAAGGCACAACTCGAGTTGTGCCTTCTTATATAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175308.2-825s1c1
Sequence:CCGGGAGATGACAGAACGGATCTGTCTCGAGACAGATCCGTTCTGTCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175308
MOB3C MISSION shRNA Lentiviral Transduction Particles
MOB kinase activator 3C
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175308.4-1349s21c1
Sequence:CCGGTGGATAGATGATGGATGTATACTCGAGTATACATCCATCATCTATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175308.4-274s21c1
Sequence:CCGGACAGCGCTTTGAGCTATATAACTCGAGTTATATAGCTCAAAGCGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175308.4-405s21c1
Sequence:CCGGACCGTATCAACCTCATCTATGCTCGAGCATAGATGAGGTTGATACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175308.2-1336s1c1
Sequence:CCGGGCTCTCATTATGGATGGATATCTCGAGATATCCATCCATAATGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175308.2-545s1c1
Sequence:CCGGCCGCTATATGGCATTGCTCATCTCGAGATGAGCAATGCCATATAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175308.2-738s1c1
Sequence:CCGGGCACATGTCAACACCTGCTATCTCGAGATAGCAGGTGTTGACATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175308.2-285s1c1
Sequence:CCGGGAGCTATATAAGAAGGCACAACTCGAGTTGTGCCTTCTTATATAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175308.2-825s1c1
Sequence:CCGGGAGATGACAGAACGGATCTGTCTCGAGACAGATCCGTTCTGTCATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)