EMAIL THIS PAGE TO A FRIEND

MOB4

MOB family member 4, phocein

195 Gene Product Result for
Synonyms: 2C4D MOB1 MOB3 MOBKL3 PHOCN PREI3
Gene ID:
Human(25843) Summary: This gene was identified based on its similarity with the mouse counterpart. Studies of the mouse counterpart suggest that the expression of this gene may be regulated during oocyte maturation and preimplantation following zygotic gene activation. Alternatively spliced transcript variants encoding distinct isoforms have been observed. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HSPE1.[provided by RefSeq, Feb 2011]
Mouse(19070) MOB family member 4, phocein
Rat(171050) MOB family member 4, phocein
sheep(101122667) MOB family member 4, phocein
Zebrafish(445045) MOB family member 4, phocein
chicken(429007) MOB family member 4, phocein
fruit fly(35576) CG3403 gene product from transcript CG3403-RA
dog(478856) MOB family member 4, phocein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301712 Anti-MOB4 affinity isolated antibody mouse, human, rat
immunohistochemistry pricing
SAB1101594 Anti-MOBKL3 (16-30) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2501432 Anti-MOBKL3 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, mouse, rat, human, bovine, rabbit, pig
ELISA, immunohistochemistry, western blot pricing
SAB4501085 Anti-MOBL3 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015387 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025283 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025283 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025283 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100819 Rosetta Predictions human pricing
NM_015387 Rosetta Predictions human pricing
NM_199482 Rosetta Predictions human pricing
NM_133528 Rosetta Predictions rat pricing
XM_001062295 Rosetta Predictions rat pricing
NM_025283 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322387 predicted 365
2 SASI_Hs02_00322388 predicted 448
3 SASI_Hs02_00322389 predicted 354
4 SASI_Hs02_00322390 predicted 324
5 SASI_Hs02_00322391 predicted 330
6 SASI_Hs02_00322392 predicted 445
7 SASI_Hs02_00322393 predicted 433
8 SASI_Hs02_00322394 predicted 575
9 SASI_Hs02_00322395 predicted 326
10 SASI_Hs02_00322396 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347742 predicted 431
2 SASI_Hs01_00120847 predicted 504
3 SASI_Hs01_00120850 predicted 414
4 SASI_Hs01_00120851 predicted 389
5 SASI_Hs02_00347743 predicted 395
6 SASI_Hs01_00120853 predicted 507
7 SASI_Hs01_00120854 predicted 493
8 SASI_Hs01_00120855 predicted 642
9 SASI_Hs02_00347744 predicted 388
10 SASI_Hs02_00347745 predicted 631
11 SASI_Hs01_00120846 predicted 780
12 SASI_Hs01_00120848 predicted 783
13 SASI_Hs01_00120849 predicted 565
14 SASI_Hs01_00120852 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372873 predicted 423
2 SASI_Hs01_00069895 predicted 498
3 SASI_Hs01_00069898 predicted 407
4 SASI_Hs01_00069899 predicted 378
5 SASI_Hs02_00372874 predicted 380
6 SASI_Hs01_00069901 predicted 491
7 SASI_Hs01_00069902 predicted 485
8 SASI_Hs01_00069903 predicted 627
9 SASI_Hs02_00372875 predicted 375
10 SASI_Hs02_00372876 predicted 617
11 SASI_Hs01_00069894 predicted 775
12 SASI_Hs01_00069896 predicted 775
13 SASI_Hs01_00069897 predicted 548
14 SASI_Hs01_00069900 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061816 predicted 746
2 SASI_Rn01_00061817 predicted 569
3 SASI_Rn01_00061818 predicted 575
4 SASI_Rn01_00061819 predicted 675
5 SASI_Rn01_00061820 predicted 721
6 SASI_Rn01_00061821 predicted 287
7 SASI_Rn01_00061822 predicted 757
8 SASI_Rn02_00267709 predicted 714
9 SASI_Rn01_00061823 predicted 197
10 SASI_Rn01_00061824 predicted 748
11 SASI_Rn01_00061825 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302976 predicted 263
2 SASI_Rn02_00302977 predicted 602
3 SASI_Rn02_00302978 predicted 614
4 SASI_Rn02_00302979 predicted 714
5 SASI_Rn02_00302980 predicted 235
6 SASI_Rn02_00302981 predicted 556
7 SASI_Rn02_00302982 predicted 755
8 SASI_Rn02_00302983 predicted 516
9 SASI_Rn02_00302984 predicted 762
10 SASI_Rn02_00302985 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025283 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064908 predicted 799
2 SASI_Mm01_00064909 predicted 332
3 SASI_Mm01_00064910 predicted 739
4 SASI_Mm01_00064911 predicted 805
5 SASI_Mm01_00064912 predicted 330
6 SASI_Mm01_00064913 predicted 254
7 SASI_Mm01_00064914 predicted 761
8 SASI_Mm01_00064915 predicted 804
9 SASI_Mm01_00064916 predicted 659
10 SASI_Mm01_00064917 predicted 693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015387
VALIDATED
MOB4 MISSION shRNA Bacterial Glycerol Stock
MOB family member 4, phocein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015387.2-152s1c1
Sequence:CCGGGCTGTTCAACAGTATATTCAACTCGAGTTGAATATACTGTTGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_015387.3-519s21c1
Sequence:CCGGGCCGTAGGATTTACAGAATATCTCGAGATATTCTGTAAATCCTACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015387.3-101s21c1
Sequence:CCGGGATTTCTATAATTGGCCTGATCTCGAGATCAGGCCAATTATAGAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015387.2-563s1c1
Sequence:CCGGCGGCAGATATTTGATGAATATCTCGAGATATTCATCAAATATCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015387.2-293s1c1
Sequence:CCGGGCTGTCAAACTTCAGAGTGAACTCGAGTTCACTCTGAAGTTTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015387.2-101s1c1
Sequence:CCGGGATTTCTATAATTGGCCTGATCTCGAGATCAGGCCAATTATAGAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015387.2-519s1c1
Sequence:CCGGGCCGTAGGATTTACAGAATATCTCGAGATATTCTGTAAATCCTACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015387.3-152s21c1
Sequence:CCGGGCTGTTCAACAGTATATTCAACTCGAGTTGAATATACTGTTGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015387.3-293s21c1
Sequence:CCGGGCTGTCAAACTTCAGAGTGAACTCGAGTTCACTCTGAAGTTTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015387
VALIDATED
MOB4 MISSION shRNA shRNA Plasmid DNA
MOB family member 4, phocein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015387.2-152s1c1
Sequence:CCGGGCTGTTCAACAGTATATTCAACTCGAGTTGAATATACTGTTGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_015387.3-519s21c1
Sequence:CCGGGCCGTAGGATTTACAGAATATCTCGAGATATTCTGTAAATCCTACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015387.3-101s21c1
Sequence:CCGGGATTTCTATAATTGGCCTGATCTCGAGATCAGGCCAATTATAGAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015387.2-563s1c1
Sequence:CCGGCGGCAGATATTTGATGAATATCTCGAGATATTCATCAAATATCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015387.2-293s1c1
Sequence:CCGGGCTGTCAAACTTCAGAGTGAACTCGAGTTCACTCTGAAGTTTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015387.2-101s1c1
Sequence:CCGGGATTTCTATAATTGGCCTGATCTCGAGATCAGGCCAATTATAGAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015387.2-519s1c1
Sequence:CCGGGCCGTAGGATTTACAGAATATCTCGAGATATTCTGTAAATCCTACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015387.3-152s21c1
Sequence:CCGGGCTGTTCAACAGTATATTCAACTCGAGTTGAATATACTGTTGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015387.3-293s21c1
Sequence:CCGGGCTGTCAAACTTCAGAGTGAACTCGAGTTCACTCTGAAGTTTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015387
VALIDATED
MOB4 MISSION shRNA Lentiviral Transduction Particles
MOB family member 4, phocein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015387.2-152s1c1
Sequence:CCGGGCTGTTCAACAGTATATTCAACTCGAGTTGAATATACTGTTGAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_015387.3-519s21c1
Sequence:CCGGGCCGTAGGATTTACAGAATATCTCGAGATATTCTGTAAATCCTACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015387.3-101s21c1
Sequence:CCGGGATTTCTATAATTGGCCTGATCTCGAGATCAGGCCAATTATAGAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015387.2-563s1c1
Sequence:CCGGCGGCAGATATTTGATGAATATCTCGAGATATTCATCAAATATCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015387.2-293s1c1
Sequence:CCGGGCTGTCAAACTTCAGAGTGAACTCGAGTTCACTCTGAAGTTTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015387.2-101s1c1
Sequence:CCGGGATTTCTATAATTGGCCTGATCTCGAGATCAGGCCAATTATAGAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015387.2-519s1c1
Sequence:CCGGGCCGTAGGATTTACAGAATATCTCGAGATATTCTGTAAATCCTACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015387.3-152s21c1
Sequence:CCGGGCTGTTCAACAGTATATTCAACTCGAGTTGAATATACTGTTGAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015387.3-293s21c1
Sequence:CCGGGCTGTCAAACTTCAGAGTGAACTCGAGTTCACTCTGAAGTTTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025283
VALIDATED
MOB4 MISSION shRNA Bacterial Glycerol Stock
MOB family member 4, phocein
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025283.2-364s1c1
Sequence:CCGGGTCCTGCCATAGATTATACAACTCGAGTTGTATAATCTATGGCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025283.2-69s1c1
Sequence:CCGGGATTTCTATAATTGGCCTGATCTCGAGATCAGGCCAATTATAGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025283.2-618s1c1
Sequence:CCGGGATAACCTGATTGTACCAATTCTCGAGAATTGGTACAATCAGGTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025283.2-405s1c1
Sequence:CCGGGCATGTCTTCTGAATAGCAATCTCGAGATTGCTATTCAGAAGACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025283.3-452s21c1
Sequence:CCGGGCATGTCTTCTGAATAGCAATCTCGAGATTGCTATTCAGAAGACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025283.3-409s21c1
Sequence:CCGGGTGTCCTGCCATAGATTATACCTCGAGGTATAATCTATGGCAGGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025283.3-1223s21c1
Sequence:CCGGTTTGATCTGCATAACGATTATCTCGAGATAATCGTTATGCAGATCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025283.3-665s21c1
Sequence:CCGGGATAACCTGATTGTACCAATTCTCGAGAATTGGTACAATCAGGTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025283.3-526s21c1
Sequence:CCGGATCAGTGTGCCGTAGGATTTACTCGAGTAAATCCTACGGCACACTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025283.2-196s1c1
Sequence:CCGGGCCAAGATGAAGGTGTATGGACTCGAGTCCATACACCTTCATCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025283.2-1044s1c1
Sequence:CCGGGACAGCATATTTGCTTTGTTTCTCGAGAAACAAAGCAAATATGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025283.2-1268s1c1
Sequence:CCGGGCCAGTGTACTTGGAAACATTCTCGAGAATGTTTCCAAGTACACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025283.2-261s1c1
Sequence:CCGGGCTGTCAAACTTCAGAGTGAACTCGAGTTCACTCTGAAGTTTGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025283.2-197s1c1
Sequence:CCGGCCAAGATGAAGGTGTATGGAACTCGAGTTCCATACACCTTCATCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025283
VALIDATED
MOB4 MISSION shRNA shRNA Plasmid DNA
MOB family member 4, phocein
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025283.2-364s1c1
Sequence:CCGGGTCCTGCCATAGATTATACAACTCGAGTTGTATAATCTATGGCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025283.2-69s1c1
Sequence:CCGGGATTTCTATAATTGGCCTGATCTCGAGATCAGGCCAATTATAGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025283.2-618s1c1
Sequence:CCGGGATAACCTGATTGTACCAATTCTCGAGAATTGGTACAATCAGGTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025283.2-405s1c1
Sequence:CCGGGCATGTCTTCTGAATAGCAATCTCGAGATTGCTATTCAGAAGACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025283.3-452s21c1
Sequence:CCGGGCATGTCTTCTGAATAGCAATCTCGAGATTGCTATTCAGAAGACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025283.3-409s21c1
Sequence:CCGGGTGTCCTGCCATAGATTATACCTCGAGGTATAATCTATGGCAGGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025283.3-1223s21c1
Sequence:CCGGTTTGATCTGCATAACGATTATCTCGAGATAATCGTTATGCAGATCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025283.3-665s21c1
Sequence:CCGGGATAACCTGATTGTACCAATTCTCGAGAATTGGTACAATCAGGTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025283.3-526s21c1
Sequence:CCGGATCAGTGTGCCGTAGGATTTACTCGAGTAAATCCTACGGCACACTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025283.2-196s1c1
Sequence:CCGGGCCAAGATGAAGGTGTATGGACTCGAGTCCATACACCTTCATCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025283.2-1044s1c1
Sequence:CCGGGACAGCATATTTGCTTTGTTTCTCGAGAAACAAAGCAAATATGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025283.2-1268s1c1
Sequence:CCGGGCCAGTGTACTTGGAAACATTCTCGAGAATGTTTCCAAGTACACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025283.2-261s1c1
Sequence:CCGGGCTGTCAAACTTCAGAGTGAACTCGAGTTCACTCTGAAGTTTGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025283.2-197s1c1
Sequence:CCGGCCAAGATGAAGGTGTATGGAACTCGAGTTCCATACACCTTCATCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025283
VALIDATED
MOB4 MISSION shRNA Lentiviral Transduction Particles
MOB family member 4, phocein
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025283.2-364s1c1
Sequence:CCGGGTCCTGCCATAGATTATACAACTCGAGTTGTATAATCTATGGCAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025283.2-69s1c1
Sequence:CCGGGATTTCTATAATTGGCCTGATCTCGAGATCAGGCCAATTATAGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025283.2-618s1c1
Sequence:CCGGGATAACCTGATTGTACCAATTCTCGAGAATTGGTACAATCAGGTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025283.2-405s1c1
Sequence:CCGGGCATGTCTTCTGAATAGCAATCTCGAGATTGCTATTCAGAAGACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025283.3-452s21c1
Sequence:CCGGGCATGTCTTCTGAATAGCAATCTCGAGATTGCTATTCAGAAGACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025283.3-409s21c1
Sequence:CCGGGTGTCCTGCCATAGATTATACCTCGAGGTATAATCTATGGCAGGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025283.3-1223s21c1
Sequence:CCGGTTTGATCTGCATAACGATTATCTCGAGATAATCGTTATGCAGATCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025283.3-665s21c1
Sequence:CCGGGATAACCTGATTGTACCAATTCTCGAGAATTGGTACAATCAGGTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025283.3-526s21c1
Sequence:CCGGATCAGTGTGCCGTAGGATTTACTCGAGTAAATCCTACGGCACACTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025283.2-196s1c1
Sequence:CCGGGCCAAGATGAAGGTGTATGGACTCGAGTCCATACACCTTCATCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025283.2-1044s1c1
Sequence:CCGGGACAGCATATTTGCTTTGTTTCTCGAGAAACAAAGCAAATATGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025283.2-1268s1c1
Sequence:CCGGGCCAGTGTACTTGGAAACATTCTCGAGAATGTTTCCAAGTACACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025283.2-261s1c1
Sequence:CCGGGCTGTCAAACTTCAGAGTGAACTCGAGTTCACTCTGAAGTTTGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025283.2-197s1c1
Sequence:CCGGCCAAGATGAAGGTGTATGGAACTCGAGTTCCATACACCTTCATCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)