EMAIL THIS PAGE TO A FRIEND

MOBP

myelin-associated oligodendrocyte basic protein

341 Gene Product Result for
UniProtKB ID: Q13875, A8K2C2, Q13874, Q6DHZ6, Q8TBJ1
Gene ID:
Mouse(17433) myelin-associated oligodendrocytic basic protein
Rat(25037) myelin-associated oligodendrocyte basic protein
cow(508625) myelin-associated oligodendrocyte basic protein
domestic cat(101098738) myelin-associated oligodendrocyte basic protein
dog(607986) myelin-associated oligodendrocyte basic protein
sheep(101113800) myelin-associated oligodendrocyte basic protein
domestic guinea pig(100733630) myelin-associated oligodendrocyte basic protein
naked mole-rat(101697147) myelin-associated oligodendrocyte basic protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006501 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006501 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006501 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008614 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008614 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008614 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006501 Rosetta Predictions human pricing
NM_182934 Rosetta Predictions human pricing
NM_182935 Rosetta Predictions human pricing
NR_003090 Rosetta Predictions human pricing
NM_012720 Rosetta Predictions rat pricing
XM_001077777 Rosetta Predictions rat pricing
NM_001039364 Rosetta Predictions mouse pricing
NM_001039365 Rosetta Predictions mouse pricing
NM_008614 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220702 predicted 535
2 SASI_Hs01_00220703 predicted 239
3 SASI_Hs01_00220704 predicted 537
4 SASI_Hs01_00220705 predicted 394
5 SASI_Hs01_00220706 predicted 537
6 SASI_Hs01_00220707 predicted 215
7 SASI_Hs01_00220708 predicted 438
8 SASI_Hs01_00220709 predicted 543
9 SASI_Hs01_00220710 predicted 90
10 SASI_Hs01_00220711 predicted 123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047690 predicted 234
2 SASI_Hs01_00047691 predicted 91
3 SASI_Hs01_00047692 predicted 121
4 SASI_Hs01_00047693 predicted 631
5 SASI_Hs01_00047694 predicted 182
6 SASI_Hs01_00047695 predicted 68
7 SASI_Hs01_00047696 predicted 638
8 SASI_Hs01_00047697 predicted 717
9 SASI_Hs01_00047698 predicted 903
10 SASI_Hs01_00047699 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371066 predicted 736
2 SASI_Hs02_00371067 predicted 491
3 SASI_Hs02_00371068 predicted 416
4 SASI_Hs02_00371069 predicted 976
5 SASI_Hs02_00371070 predicted 891
6 SASI_Hs01_00110088 predicted 573
7 SASI_Hs02_00371071 predicted 971
8 SASI_Hs02_00371072 predicted 809
9 SASI_Hs02_00371073 predicted 683
10 SASI_Hs02_00371074 predicted 735
11 SASI_Hs01_00110089 predicted 265
12 SASI_Hs01_00110090 predicted 2499
13 SASI_Hs01_00110091 predicted 1910
14 SASI_Hs01_00110092 predicted 2218
15 SASI_Hs01_00110093 predicted 1998
16 SASI_Hs01_00110094 predicted 1248
17 SASI_Hs01_00110095 predicted 2208
18 SASI_Hs01_00110096 predicted 1833
19 SASI_Hs01_00110097 predicted 1934
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378156 predicted 2006
2 SASI_Hs02_00378157 predicted 2171
3 SASI_Hs02_00378158 predicted 2302
4 SASI_Hs02_00378159 predicted 2097
5 SASI_Hs02_00378160 predicted 2183
6 SASI_Hs02_00378161 predicted 2298
7 SASI_Hs02_00378162 predicted 1925
8 SASI_Hs02_00378163 predicted 2018
9 SASI_Hs02_00378164 predicted 1709
10 SASI_Hs02_00378165 predicted 2246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070996 predicted 412
2 SASI_Rn01_00070997 predicted 660
3 SASI_Rn01_00070998 predicted 629
4 SASI_Rn01_00070999 predicted 388
5 SASI_Rn01_00071000 predicted 803
6 SASI_Rn01_00071001 predicted 464
7 SASI_Rn01_00071002 predicted 357
8 SASI_Rn01_00071003 predicted 693
9 SASI_Rn01_00071004 predicted 385
10 SASI_Rn01_00071005 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358502 predicted 211
2 SASI_Rn02_00358503 predicted 408
3 SASI_Rn02_00358504 predicted 244
4 SASI_Rn02_00358505 predicted 268
5 SASI_Rn02_00358506 predicted 219
6 SASI_Rn02_00358507 predicted 301
7 SASI_Rn02_00358508 predicted 427
8 SASI_Rn02_00358509 predicted 517
9 SASI_Rn02_00358510 predicted 243
10 SASI_Rn02_00358511 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200450 predicted 356
2 SASI_Mm01_00200451 predicted 387
3 SASI_Mm01_00200452 predicted 378
4 SASI_Mm01_00200453 predicted 305
5 SASI_Mm01_00200454 predicted 659
6 SASI_Mm01_00200455 predicted 176
7 SASI_Mm01_00200456 predicted 166
8 SASI_Mm01_00200457 predicted 607
9 SASI_Mm01_00200458 predicted 642
10 SASI_Mm01_00200459 predicted 192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079759 predicted 1024
2 SASI_Mm01_00079760 predicted 831
3 SASI_Mm02_00290019 predicted 900
4 SASI_Mm01_00079762 predicted 1021
5 SASI_Mm01_00079763 predicted 957
6 SASI_Mm01_00079764 predicted 862
7 SASI_Mm01_00079765 predicted 906
8 SASI_Mm01_00079766 predicted 1074
9 SASI_Mm02_00290020 predicted 1044
10 SASI_Mm01_00079768 predicted 975
11 SASI_Mm01_00079761 predicted 654
12 SASI_Mm01_00079767 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076971 predicted 441
2 SASI_Mm01_00076972 predicted 469
3 SASI_Mm01_00076973 predicted 453
4 SASI_Mm01_00076974 predicted 381
5 SASI_Mm01_00076975 predicted 738
6 SASI_Mm01_00076976 predicted 257
7 SASI_Mm01_00076977 predicted 248
8 SASI_Mm01_00076978 predicted 687
9 SASI_Mm01_00076979 predicted 719
10 SASI_Mm01_00076980 predicted 267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006501
MOBP MISSION shRNA Bacterial Glycerol Stock
myelin-associated oligodendrocyte basic protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006501.1-104s1c1
Sequence:CCGGCCTCAATTCCAAGAAGGAGATCTCGAGATCTCCTTCTTGGAATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006501.1-131s1c1
Sequence:CCGGTCGGAAATACAGCATCTGTAACTCGAGTTACAGATGCTGTATTTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006501.1-535s1c1
Sequence:CCGGCCGTCAAAGCTTCTAGGTTCTCTCGAGAGAACCTAGAAGCTTTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006501.1-53s1c1
Sequence:CCGGCCAGAAGTACTCCGAACACTTCTCGAGAAGTGTTCGGAGTACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006501.1-155s1c1
Sequence:CCGGCGGCTGCTTCTACCAGAAGAACTCGAGTTCTTCTGGTAGAAGCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006501
MOBP MISSION shRNA shRNA Plasmid DNA
myelin-associated oligodendrocyte basic protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006501.1-104s1c1
Sequence:CCGGCCTCAATTCCAAGAAGGAGATCTCGAGATCTCCTTCTTGGAATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006501.1-131s1c1
Sequence:CCGGTCGGAAATACAGCATCTGTAACTCGAGTTACAGATGCTGTATTTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006501.1-535s1c1
Sequence:CCGGCCGTCAAAGCTTCTAGGTTCTCTCGAGAGAACCTAGAAGCTTTGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006501.1-53s1c1
Sequence:CCGGCCAGAAGTACTCCGAACACTTCTCGAGAAGTGTTCGGAGTACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006501.1-155s1c1
Sequence:CCGGCGGCTGCTTCTACCAGAAGAACTCGAGTTCTTCTGGTAGAAGCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006501
MOBP MISSION shRNA Lentiviral Transduction Particles
myelin-associated oligodendrocyte basic protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006501.1-104s1c1
Sequence:CCGGCCTCAATTCCAAGAAGGAGATCTCGAGATCTCCTTCTTGGAATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006501.1-131s1c1
Sequence:CCGGTCGGAAATACAGCATCTGTAACTCGAGTTACAGATGCTGTATTTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006501.1-535s1c1
Sequence:CCGGCCGTCAAAGCTTCTAGGTTCTCTCGAGAGAACCTAGAAGCTTTGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006501.1-53s1c1
Sequence:CCGGCCAGAAGTACTCCGAACACTTCTCGAGAAGTGTTCGGAGTACTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006501.1-155s1c1
Sequence:CCGGCGGCTGCTTCTACCAGAAGAACTCGAGTTCTTCTGGTAGAAGCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008614
MOBP MISSION shRNA Bacterial Glycerol Stock
myelin-associated oligodendrocyte basic protein
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000089740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008614.2-328s1c1
Sequence:CCGGTGCCTGCCAGAAGACTAGATTCTCGAGAATCTAGTCTTCTGGCAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008614.2-2230s1c1
Sequence:CCGGGCCCAAACTTTGGTAAGTTATCTCGAGATAACTTACCAAAGTTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008614.2-184s1c1
Sequence:CCGGCCAGAAGTTCTCCGAGCACTTCTCGAGAAGTGCTCGGAGAACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008614.2-172s1c1
Sequence:CCGGGCTCTCCAAGAACCAGAAGTTCTCGAGAACTTCTGGTTCTTGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008614
MOBP MISSION shRNA shRNA Plasmid DNA
myelin-associated oligodendrocyte basic protein
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000089740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008614.2-328s1c1
Sequence:CCGGTGCCTGCCAGAAGACTAGATTCTCGAGAATCTAGTCTTCTGGCAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008614.2-2230s1c1
Sequence:CCGGGCCCAAACTTTGGTAAGTTATCTCGAGATAACTTACCAAAGTTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008614.2-184s1c1
Sequence:CCGGCCAGAAGTTCTCCGAGCACTTCTCGAGAAGTGCTCGGAGAACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008614.2-172s1c1
Sequence:CCGGGCTCTCCAAGAACCAGAAGTTCTCGAGAACTTCTGGTTCTTGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008614
MOBP MISSION shRNA Lentiviral Transduction Particles
myelin-associated oligodendrocyte basic protein
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000089740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008614.2-328s1c1
Sequence:CCGGTGCCTGCCAGAAGACTAGATTCTCGAGAATCTAGTCTTCTGGCAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008614.2-2230s1c1
Sequence:CCGGGCCCAAACTTTGGTAAGTTATCTCGAGATAACTTACCAAAGTTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008614.2-184s1c1
Sequence:CCGGCCAGAAGTTCTCCGAGCACTTCTCGAGAAGTGCTCGGAGAACTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008614.2-172s1c1
Sequence:CCGGGCTCTCCAAGAACCAGAAGTTCTCGAGAACTTCTGGTTCTTGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)