EMAIL THIS PAGE TO A FRIEND

MOCS1

molybdenum cofactor synthesis 1

110 Gene Product Result for
Synonyms: MIG11 MOCOD
Gene ID:
Human(4337) Summary: Molybdenum cofactor biosynthesis is a conserved pathway leading to the biological activation of molybdenum. The protein encoded by this gene is involved in this pathway. This gene was originally thought to produce a bicistronic mRNA with the potential to produce two proteins (MOCS1A and MOCS1B) from adjacent open reading frames. However, only the first open reading frame (MOCS1A) has been found to encode a protein from the putative bicistronic mRNA, whereas additional splice variants, whose full-length natures have yet to be determined, are likely to produce a fusion between the two open reading frames. This gene is defective in patients with molybdenum cofactor deficiency, type A. A related pseudogene has been identified on chromosome 16. [provided by RefSeq, Jan 2010]
Mouse(56738) molybdenum cofactor synthesis 1
Rat(301221) molybdenum cofactor synthesis 1
Zebrafish(793471) molybdenum cofactor synthesis 1
fruit fly(39238) Molybdenum cofactor synthesis 1 ortholog
Horse(100065704) molybdenum cofactor synthesis 1
cow(281917) molybdenum cofactor synthesis 1
dog(481784) molybdenum cofactor synthesis 1
chicken(395270) molybdenum cofactor synthesis 1
domestic guinea pig(100719341) molybdenum cofactor synthesis 1
Domestic Rabbit(100009474) molybdenum cofactor synthesis 1
naked mole-rat(101723572) molybdenum cofactor synthesis 1
sheep(101106721) molybdenum cofactor synthesis 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005942 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005942 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005942 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020042 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020042 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020042 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001075098 Rosetta Predictions human pricing
NM_005942 Rosetta Predictions human pricing
NM_005943 Rosetta Predictions human pricing
NM_138928 Rosetta Predictions human pricing
NM_001106881 Rosetta Predictions rat pricing
NM_020042 Rosetta Predictions mouse pricing
NM_028464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001075098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311906 predicted 1503
2 SASI_Hs02_00311907 predicted 495
3 SASI_Hs02_00311908 predicted 862
4 SASI_Hs02_00311909 predicted 779
5 SASI_Hs02_00311910 predicted 1495
6 SASI_Hs02_00311911 predicted 608
7 SASI_Hs02_00311912 predicted 681
8 SASI_Hs02_00311913 predicted 565
9 SASI_Hs02_00311914 predicted 698
10 SASI_Hs02_00311915 predicted 1450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196581 predicted 2103
2 SASI_Hs01_00196582 predicted 1569
3 SASI_Hs01_00196584 predicted 2094
4 SASI_Hs02_00340600 predicted 2265
5 SASI_Hs01_00196587 predicted 574
6 SASI_Hs02_00340601 predicted 2338
7 SASI_Hs02_00340602 predicted 2309
8 SASI_Hs01_00196590 predicted 763
9 SASI_Hs02_00340603 predicted 2199
10 SASI_Hs02_00340604 predicted 767
11 SASI_Hs01_00196583 predicted 918
12 SASI_Hs01_00196585 predicted 592
13 SASI_Hs01_00196586 predicted 1686
14 SASI_Hs01_00196588 predicted 2137
15 SASI_Hs01_00196589 predicted 1721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229708 predicted 1577
2 SASI_Hs01_00229710 predicted 573
3 SASI_Hs02_00340605 predicted 938
4 SASI_Hs01_00229712 predicted 852
5 SASI_Hs01_00229713 predicted 1572
6 SASI_Hs01_00229714 predicted 686
7 SASI_Hs01_00229715 predicted 757
8 SASI_Hs02_00340606 predicted 642
9 SASI_Hs01_00229716 predicted 772
10 SASI_Hs01_00229717 predicted 1522
11 SASI_Hs01_00229709 predicted 350
12 SASI_Hs01_00229711 predicted 1729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213213 predicted 2059
2 SASI_Hs01_00213214 predicted 1515
3 SASI_Hs01_00213216 predicted 2044
4 SASI_Hs02_00363999 predicted 2212
5 SASI_Hs01_00213219 predicted 575
6 SASI_Hs02_00364000 predicted 2261
7 SASI_Hs01_00213222 predicted 758
8 SASI_Hs02_00364001 predicted 2151
9 SASI_Hs02_00364002 predicted 771
10 SASI_Hs02_00364003 predicted 2206
11 SASI_Hs01_00213215 predicted 926
12 SASI_Hs01_00213217 predicted 585
13 SASI_Hs01_00213218 predicted 1637
14 SASI_Hs01_00213220 predicted 2093
15 SASI_Hs01_00213221 predicted 1672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106881 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223326 predicted 835
2 SASI_Rn02_00223327 predicted 1013
3 SASI_Rn02_00223328 predicted 1033
4 SASI_Rn02_00223329 predicted 315
5 SASI_Rn02_00223330 predicted 496
6 SASI_Rn02_00223331 predicted 592
7 SASI_Rn02_00223332 predicted 820
8 SASI_Rn02_00223333 predicted 942
9 SASI_Rn02_00223334 predicted 789
10 SASI_Rn02_00223335 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020042 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152608 predicted 1445
2 SASI_Mm02_00325402 predicted 670
3 SASI_Mm01_00152609 predicted 1503
4 SASI_Mm02_00325403 predicted 830
5 SASI_Mm01_00152612 predicted 1423
6 SASI_Mm02_00325404 predicted 633
7 SASI_Mm02_00325405 predicted 711
8 SASI_Mm02_00325406 predicted 967
9 SASI_Mm02_00325407 predicted 697
10 SASI_Mm02_00325408 predicted 279
11 SASI_Mm01_00152604 predicted 813
12 SASI_Mm01_00152605 predicted 857
13 SASI_Mm01_00152606 predicted 430
14 SASI_Mm01_00152607 predicted 633
15 SASI_Mm01_00152610 predicted 255
16 SASI_Mm01_00152611 predicted 381
17 SASI_Mm01_00152613 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333905 predicted 1459
2 SASI_Mm02_00333906 predicted 664
3 SASI_Mm02_00333907 predicted 1520
4 SASI_Mm02_00333908 predicted 834
5 SASI_Mm02_00333909 predicted 1457
6 SASI_Mm02_00333910 predicted 1440
7 SASI_Mm02_00333911 predicted 636
8 SASI_Mm02_00333912 predicted 974
9 SASI_Mm02_00333913 predicted 1525
10 SASI_Mm02_00333914 predicted 698
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005942
VALIDATED
MOCS1 MISSION shRNA Bacterial Glycerol Stock
molybdenum cofactor synthesis 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005942.3-814s21c1
Sequence:CCGGGAGGATGAACTCCTGGACTTTCTCGAGAAAGTCCAGGAGTTCATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005942.3-688s21c1
Sequence:CCGGCCTGCCAAGTTTGAGTTCATTCTCGAGAATGAACTCAAACTTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005942.3-474s21c1
Sequence:CCGGGCTCTTTGTGAAGGAAGGCATCTCGAGATGCCTTCCTTCACAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005942.1-685s1c1
Sequence:CCGGCCTGCCAAGTTTGAGTTCATTCTCGAGAATGAACTCAAACTTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005942.1-471s1c1
Sequence:CCGGGCTCTTTGTGAAGGAAGGCATCTCGAGATGCCTTCCTTCACAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005942.1-1493s1c1
Sequence:CCGGCAGACTCAGATGCCAACTCAACTCGAGTTGAGTTGGCATCTGAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005942.1-1270s1c1
Sequence:CCGGCCCATGATCCTCATCAAGTTACTCGAGTAACTTGATGAGGATCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005942.3-1496s21c1
Sequence:CCGGCAGACTCAGATGCCAACTCAACTCGAGTTGAGTTGGCATCTGAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005942.1-811s1c1
Sequence:CCGGGAGGATGAACTCCTGGACTTTCTCGAGAAAGTCCAGGAGTTCATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005942
VALIDATED
MOCS1 MISSION shRNA shRNA Plasmid DNA
molybdenum cofactor synthesis 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005942.3-814s21c1
Sequence:CCGGGAGGATGAACTCCTGGACTTTCTCGAGAAAGTCCAGGAGTTCATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005942.3-688s21c1
Sequence:CCGGCCTGCCAAGTTTGAGTTCATTCTCGAGAATGAACTCAAACTTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005942.3-474s21c1
Sequence:CCGGGCTCTTTGTGAAGGAAGGCATCTCGAGATGCCTTCCTTCACAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005942.1-685s1c1
Sequence:CCGGCCTGCCAAGTTTGAGTTCATTCTCGAGAATGAACTCAAACTTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005942.1-471s1c1
Sequence:CCGGGCTCTTTGTGAAGGAAGGCATCTCGAGATGCCTTCCTTCACAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005942.1-1493s1c1
Sequence:CCGGCAGACTCAGATGCCAACTCAACTCGAGTTGAGTTGGCATCTGAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005942.1-1270s1c1
Sequence:CCGGCCCATGATCCTCATCAAGTTACTCGAGTAACTTGATGAGGATCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005942.3-1496s21c1
Sequence:CCGGCAGACTCAGATGCCAACTCAACTCGAGTTGAGTTGGCATCTGAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005942.1-811s1c1
Sequence:CCGGGAGGATGAACTCCTGGACTTTCTCGAGAAAGTCCAGGAGTTCATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005942
VALIDATED
MOCS1 MISSION shRNA Lentiviral Transduction Particles
molybdenum cofactor synthesis 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005942.3-814s21c1
Sequence:CCGGGAGGATGAACTCCTGGACTTTCTCGAGAAAGTCCAGGAGTTCATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005942.3-688s21c1
Sequence:CCGGCCTGCCAAGTTTGAGTTCATTCTCGAGAATGAACTCAAACTTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005942.3-474s21c1
Sequence:CCGGGCTCTTTGTGAAGGAAGGCATCTCGAGATGCCTTCCTTCACAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005942.1-685s1c1
Sequence:CCGGCCTGCCAAGTTTGAGTTCATTCTCGAGAATGAACTCAAACTTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005942.1-471s1c1
Sequence:CCGGGCTCTTTGTGAAGGAAGGCATCTCGAGATGCCTTCCTTCACAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005942.1-1493s1c1
Sequence:CCGGCAGACTCAGATGCCAACTCAACTCGAGTTGAGTTGGCATCTGAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005942.1-1270s1c1
Sequence:CCGGCCCATGATCCTCATCAAGTTACTCGAGTAACTTGATGAGGATCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005942.3-1496s21c1
Sequence:CCGGCAGACTCAGATGCCAACTCAACTCGAGTTGAGTTGGCATCTGAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005942.1-811s1c1
Sequence:CCGGGAGGATGAACTCCTGGACTTTCTCGAGAAAGTCCAGGAGTTCATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020042
MOCS1 MISSION shRNA Bacterial Glycerol Stock
molybdenum cofactor synthesis 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020042.1-340s1c1
Sequence:CCGGCAGAGACACTACAGCTCCTATCTCGAGATAGGAGCTGTAGTGTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020042.1-215s1c1
Sequence:CCGGCCCTCCGTGTTCGGAATCCAACTCGAGTTGGATTCCGAACACGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020042.1-981s1c1
Sequence:CCGGTCCCTCTAAATCTAGTGATTACTCGAGTAATCACTAGATTTAGAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020042.1-436s1c1
Sequence:CCGGACCTCAAATCAGCTAACTCATCTCGAGATGAGTTAGCTGATTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020042.1-857s1c1
Sequence:CCGGCAGAGGTGAAGCTCATTAGTACTCGAGTACTAATGAGCTTCACCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020042
MOCS1 MISSION shRNA shRNA Plasmid DNA
molybdenum cofactor synthesis 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020042.1-340s1c1
Sequence:CCGGCAGAGACACTACAGCTCCTATCTCGAGATAGGAGCTGTAGTGTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020042.1-215s1c1
Sequence:CCGGCCCTCCGTGTTCGGAATCCAACTCGAGTTGGATTCCGAACACGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020042.1-981s1c1
Sequence:CCGGTCCCTCTAAATCTAGTGATTACTCGAGTAATCACTAGATTTAGAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020042.1-436s1c1
Sequence:CCGGACCTCAAATCAGCTAACTCATCTCGAGATGAGTTAGCTGATTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020042.1-857s1c1
Sequence:CCGGCAGAGGTGAAGCTCATTAGTACTCGAGTACTAATGAGCTTCACCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020042
MOCS1 MISSION shRNA Lentiviral Transduction Particles
molybdenum cofactor synthesis 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020042.1-340s1c1
Sequence:CCGGCAGAGACACTACAGCTCCTATCTCGAGATAGGAGCTGTAGTGTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020042.1-215s1c1
Sequence:CCGGCCCTCCGTGTTCGGAATCCAACTCGAGTTGGATTCCGAACACGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020042.1-981s1c1
Sequence:CCGGTCCCTCTAAATCTAGTGATTACTCGAGTAATCACTAGATTTAGAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020042.1-436s1c1
Sequence:CCGGACCTCAAATCAGCTAACTCATCTCGAGATGAGTTAGCTGATTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020042.1-857s1c1
Sequence:CCGGCAGAGGTGAAGCTCATTAGTACTCGAGTACTAATGAGCTTCACCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)