EMAIL THIS PAGE TO A FRIEND

MOCS2

molybdenum cofactor synthesis 2

127 Gene Product Result for
Synonyms: MCBPE MOCO1 MPTS
UniProtKB ID: O96033
Gene ID:
Human(4338) Summary: Eukaryotic molybdoenzymes use a unique molybdenum cofactor (MoCo) consisting of a pterin, termed molybdopterin, and the catalytically active metal molybdenum. MoCo is synthesized from precursor Z by the heterodimeric enzyme molybdopterin synthase. The large and small subunits of molybdopterin synthase are both encoded from this gene by overlapping open reading frames. The proteins were initially thought to be encoded from a bicistronic transcript. They are now thought to be encoded from monocistronic transcripts. Alternatively spliced transcripts have been found for this locus that encode the large and small subunits. [provided by RefSeq, Jul 2008]
Mouse(17434) molybdenum cofactor synthesis 2
Rat(294753) molybdenum cofactor synthesis 2
Zebrafish(100003554) molybdenum cofactor synthesis 2
fruit fly(43017) Molybdopterin synthase 2
domestic cat(101089492) molybdenum cofactor synthesis 2
cow(507986) molybdenum cofactor synthesis 2
dog(479337) molybdenum cofactor synthesis 2
chicken(427199) molybdenum cofactor synthesis 2
sheep(101119420) molybdenum cofactor synthesis 2
naked mole-rat(101701123) molybdenum cofactor synthesis 2
domestic guinea pig(100728145) molybdenum cofactor synthesis 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013826 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013826 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013826 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004531 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079461 MISSION® esiRNA esiRNA human MOCS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004531 Rosetta Predictions human pricing
NM_176806 Rosetta Predictions human pricing
NM_183418 Rosetta Predictions human pricing
NM_001007633 Rosetta Predictions rat pricing
XM_001067999 Rosetta Predictions rat pricing
XM_001068053 Rosetta Predictions rat pricing
NM_001113374 Rosetta Predictions mouse pricing
NM_001113375 Rosetta Predictions mouse pricing
NM_013826 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230859 predicted 738
2 SASI_Hs01_00230860 predicted 1022
3 SASI_Hs01_00230861 predicted 851
4 SASI_Hs01_00230862 predicted 806
5 SASI_Hs01_00230863 predicted 923
6 SASI_Hs01_00230864 predicted 687
7 SASI_Hs01_00230865 predicted 1080
8 SASI_Hs01_00230867 predicted 1065
9 SASI_Hs02_00337829 predicted 733
10 SASI_Hs02_00337830 predicted 907
11 SASI_Hs01_00230866 predicted 999
12 SASI_Hs01_00230868 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172322 predicted 556
2 SASI_Hs01_00172324 predicted 658
3 SASI_Hs01_00172325 predicted 622
4 SASI_Hs01_00172326 predicted 737
5 SASI_Hs01_00172327 predicted 503
6 SASI_Hs01_00172330 predicted 541
7 SASI_Hs02_00369218 predicted 725
8 SASI_Hs01_00172331 predicted 383
9 SASI_Hs02_00369219 predicted 672
10 SASI_Hs02_00369220 predicted 376
11 SASI_Hs01_00172323 predicted 447
12 SASI_Hs01_00172328 predicted 583
13 SASI_Hs01_00172329 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070772 predicted 556
2 SASI_Hs01_00070773 predicted 837
3 SASI_Hs01_00070774 predicted 669
4 SASI_Hs01_00070775 predicted 622
5 SASI_Hs01_00070776 predicted 741
6 SASI_Hs01_00070777 predicted 505
7 SASI_Hs01_00070778 predicted 891
8 SASI_Hs01_00070779 predicted 818
9 SASI_Hs01_00070780 predicted 883
10 SASI_Hs01_00070781 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061302 predicted 844
2 SASI_Rn01_00061303 predicted 577
3 SASI_Rn01_00061304 predicted 777
4 SASI_Rn01_00061305 predicted 501
5 SASI_Rn01_00061306 predicted 515
6 SASI_Rn01_00061307 predicted 388
7 SASI_Rn02_00198738 predicted 378
8 SASI_Rn01_00061308 predicted 389
9 SASI_Rn01_00061309 predicted 862
10 SASI_Rn01_00061310 predicted 520
11 SASI_Rn01_00061311 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323066 predicted 843
2 SASI_Rn02_00323067 predicted 845
3 SASI_Rn02_00323068 predicted 910
4 SASI_Rn02_00323069 predicted 753
5 SASI_Rn02_00323070 predicted 851
6 SASI_Rn02_00323071 predicted 364
7 SASI_Rn02_00323072 predicted 859
8 SASI_Rn02_00323073 predicted 640
9 SASI_Rn02_00323074 predicted 295
10 SASI_Rn02_00323075 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323255 predicted 846
2 SASI_Rn02_00323256 predicted 839
3 SASI_Rn02_00323257 predicted 911
4 SASI_Rn02_00323258 predicted 760
5 SASI_Rn02_00323259 predicted 844
6 SASI_Rn02_00323260 predicted 361
7 SASI_Rn02_00323261 predicted 859
8 SASI_Rn02_00323262 predicted 640
9 SASI_Rn02_00323263 predicted 298
10 SASI_Rn02_00323264 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307568 predicted 1176
2 SASI_Mm02_00307569 predicted 1035
3 SASI_Mm02_00307570 predicted 1009
4 SASI_Mm02_00307571 predicted 766
5 SASI_Mm02_00307572 predicted 812
6 SASI_Mm02_00307573 predicted 1132
7 SASI_Mm02_00307574 predicted 1106
8 SASI_Mm02_00307575 predicted 1115
9 SASI_Mm02_00307576 predicted 954
10 SASI_Mm02_00307577 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307578 predicted 1078
2 SASI_Mm02_00307579 predicted 935
3 SASI_Mm02_00307580 predicted 907
4 SASI_Mm02_00307581 predicted 669
5 SASI_Mm02_00307582 predicted 720
6 SASI_Mm02_00307583 predicted 1044
7 SASI_Mm02_00307584 predicted 1010
8 SASI_Mm02_00307585 predicted 1013
9 SASI_Mm02_00307586 predicted 863
10 SASI_Mm02_00307587 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322806 predicted 373
2 SASI_Mm02_00322807 predicted 574
3 SASI_Mm01_00021412 predicted 505
4 SASI_Mm02_00322808 predicted 768
5 SASI_Mm02_00322809 predicted 228
6 SASI_Mm01_00021415 predicted 482
7 SASI_Mm02_00322810 predicted 786
8 SASI_Mm02_00322811 predicted 76
9 SASI_Mm01_00021417 predicted 518
10 SASI_Mm02_00322812 predicted 609
11 SASI_Mm01_00021409 predicted 444
12 SASI_Mm01_00021410 predicted 727
13 SASI_Mm01_00021411 predicted 601
14 SASI_Mm01_00021413 predicted 656
15 SASI_Mm01_00021414 predicted 416
16 SASI_Mm01_00021416 predicted 549
17 SASI_Mm01_00021418 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013826
VALIDATED
MOCS2 MISSION shRNA Bacterial Glycerol Stock
molybdenum cofactor synthesis 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013826.1-722s1c1
Sequence:CCGGCCTGTGATAAGATGTCTGCAACTCGAGTTGCAGACATCTTATCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013826.1-608s1c1
Sequence:CCGGGCACAGTTATTGCTGTGTCTTCTCGAGAAGACACAGCAATAACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013826.1-422s1c1
Sequence:CCGGCTCTCTTTGTAGGGACTACAACTCGAGTTGTAGTCCCTACAAAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013826.1-662s1c1
Sequence:CCGGGCTACGCCATTGATTCTTTAACTCGAGTTAAAGAATCAATGGCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013826.1-268s1c1
Sequence:CCGGCGCCAATCAGTGGAGGATAATCTCGAGATTATCCTCCACTGATTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013826.3-960s21c1
Sequence:CCGGCCTGTGATAAGATGTCTGCAACTCGAGTTGCAGACATCTTATCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013826.3-471s21c1
Sequence:CCGGCTCTCTTTGTAGGGACTACAACTCGAGTTGTAGTCCCTACAAAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013826.3-317s21c1
Sequence:CCGGCGCCAATCAGTGGAGGATAATCTCGAGATTATCCTCCACTGATTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013826.3-711s21c1
Sequence:CCGGGCTACGCCATTGATTCTTTAACTCGAGTTAAAGAATCAATGGCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013826
VALIDATED
MOCS2 MISSION shRNA shRNA Plasmid DNA
molybdenum cofactor synthesis 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013826.1-722s1c1
Sequence:CCGGCCTGTGATAAGATGTCTGCAACTCGAGTTGCAGACATCTTATCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013826.1-608s1c1
Sequence:CCGGGCACAGTTATTGCTGTGTCTTCTCGAGAAGACACAGCAATAACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013826.1-422s1c1
Sequence:CCGGCTCTCTTTGTAGGGACTACAACTCGAGTTGTAGTCCCTACAAAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013826.1-662s1c1
Sequence:CCGGGCTACGCCATTGATTCTTTAACTCGAGTTAAAGAATCAATGGCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013826.1-268s1c1
Sequence:CCGGCGCCAATCAGTGGAGGATAATCTCGAGATTATCCTCCACTGATTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013826.3-960s21c1
Sequence:CCGGCCTGTGATAAGATGTCTGCAACTCGAGTTGCAGACATCTTATCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013826.3-471s21c1
Sequence:CCGGCTCTCTTTGTAGGGACTACAACTCGAGTTGTAGTCCCTACAAAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013826.3-317s21c1
Sequence:CCGGCGCCAATCAGTGGAGGATAATCTCGAGATTATCCTCCACTGATTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013826.3-711s21c1
Sequence:CCGGGCTACGCCATTGATTCTTTAACTCGAGTTAAAGAATCAATGGCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013826
VALIDATED
MOCS2 MISSION shRNA Lentiviral Transduction Particles
molybdenum cofactor synthesis 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013826.1-722s1c1
Sequence:CCGGCCTGTGATAAGATGTCTGCAACTCGAGTTGCAGACATCTTATCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013826.1-608s1c1
Sequence:CCGGGCACAGTTATTGCTGTGTCTTCTCGAGAAGACACAGCAATAACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013826.1-422s1c1
Sequence:CCGGCTCTCTTTGTAGGGACTACAACTCGAGTTGTAGTCCCTACAAAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013826.1-662s1c1
Sequence:CCGGGCTACGCCATTGATTCTTTAACTCGAGTTAAAGAATCAATGGCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013826.1-268s1c1
Sequence:CCGGCGCCAATCAGTGGAGGATAATCTCGAGATTATCCTCCACTGATTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013826.3-960s21c1
Sequence:CCGGCCTGTGATAAGATGTCTGCAACTCGAGTTGCAGACATCTTATCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013826.3-471s21c1
Sequence:CCGGCTCTCTTTGTAGGGACTACAACTCGAGTTGTAGTCCCTACAAAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013826.3-317s21c1
Sequence:CCGGCGCCAATCAGTGGAGGATAATCTCGAGATTATCCTCCACTGATTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013826.3-711s21c1
Sequence:CCGGGCTACGCCATTGATTCTTTAACTCGAGTTAAAGAATCAATGGCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004531
VALIDATED
MOCS2 MISSION shRNA Bacterial Glycerol Stock
molybdenum cofactor synthesis 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004531.3-629s1c1
Sequence:CCGGCCCTATTTGTAGGGACTACAACTCGAGTTGTAGTCCCTACAAATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004531.3-501s1c1
Sequence:CCGGTGAGCCATCTAGGAAAGATATCTCGAGATATCTTTCCTAGATGGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004531.3-799s1c1
Sequence:CCGGCCAGTGTCAGAAGCAAGCATACTCGAGTATGCTTGCTTCTGACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004531.3-862s1c1
Sequence:CCGGGCTGTGAGCTATGCCATTGATCTCGAGATCAATGGCATAGCTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004531.3-862s21c1
Sequence:CCGGGCTGTGAGCTATGCCATTGATCTCGAGATCAATGGCATAGCTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004531.3-501s21c1
Sequence:CCGGTGAGCCATCTAGGAAAGATATCTCGAGATATCTTTCCTAGATGGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_004531.3-629s21c1
Sequence:CCGGCCCTATTTGTAGGGACTACAACTCGAGTTGTAGTCCCTACAAATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004531.3-799s21c1
Sequence:CCGGCCAGTGTCAGAAGCAAGCATACTCGAGTATGCTTGCTTCTGACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004531
VALIDATED
MOCS2 MISSION shRNA shRNA Plasmid DNA
molybdenum cofactor synthesis 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004531.3-629s1c1
Sequence:CCGGCCCTATTTGTAGGGACTACAACTCGAGTTGTAGTCCCTACAAATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004531.3-501s1c1
Sequence:CCGGTGAGCCATCTAGGAAAGATATCTCGAGATATCTTTCCTAGATGGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004531.3-799s1c1
Sequence:CCGGCCAGTGTCAGAAGCAAGCATACTCGAGTATGCTTGCTTCTGACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004531.3-862s1c1
Sequence:CCGGGCTGTGAGCTATGCCATTGATCTCGAGATCAATGGCATAGCTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004531.3-862s21c1
Sequence:CCGGGCTGTGAGCTATGCCATTGATCTCGAGATCAATGGCATAGCTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004531.3-501s21c1
Sequence:CCGGTGAGCCATCTAGGAAAGATATCTCGAGATATCTTTCCTAGATGGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_004531.3-629s21c1
Sequence:CCGGCCCTATTTGTAGGGACTACAACTCGAGTTGTAGTCCCTACAAATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004531.3-799s21c1
Sequence:CCGGCCAGTGTCAGAAGCAAGCATACTCGAGTATGCTTGCTTCTGACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004531
VALIDATED
MOCS2 MISSION shRNA Lentiviral Transduction Particles
molybdenum cofactor synthesis 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004531.3-629s1c1
Sequence:CCGGCCCTATTTGTAGGGACTACAACTCGAGTTGTAGTCCCTACAAATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004531.3-501s1c1
Sequence:CCGGTGAGCCATCTAGGAAAGATATCTCGAGATATCTTTCCTAGATGGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004531.3-799s1c1
Sequence:CCGGCCAGTGTCAGAAGCAAGCATACTCGAGTATGCTTGCTTCTGACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004531.3-862s1c1
Sequence:CCGGGCTGTGAGCTATGCCATTGATCTCGAGATCAATGGCATAGCTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004531.3-862s21c1
Sequence:CCGGGCTGTGAGCTATGCCATTGATCTCGAGATCAATGGCATAGCTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004531.3-501s21c1
Sequence:CCGGTGAGCCATCTAGGAAAGATATCTCGAGATATCTTTCCTAGATGGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_004531.3-629s21c1
Sequence:CCGGCCCTATTTGTAGGGACTACAACTCGAGTTGTAGTCCCTACAAATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004531.3-799s21c1
Sequence:CCGGCCAGTGTCAGAAGCAAGCATACTCGAGTATGCTTGCTTCTGACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)