EMAIL THIS PAGE TO A FRIEND

MOCS3

molybdenum cofactor synthesis 3

72 Gene Product Result for
Synonyms: UBA4
UniProtKB ID: O95396
Gene ID:
Human(27304) Summary: Molybdenum cofactor (MoCo) is necessary for the function of all molybdoenzymes. The protein encoded by this gene adenylates and activates molybdopterin synthase, an enzyme required for biosynthesis of MoCo. This gene contains no introns. A pseudogene of this gene is present on chromosome 14. [provided by RefSeq, Nov 2012]
Mouse(69372) molybdenum cofactor synthesis 3
Rat(311655) molybdenum cofactor synthesis 3
domestic guinea pig(100729606) molybdenum cofactor synthesis 3
naked mole-rat(101722943) molybdenum cofactor synthesis 3
Domestic Rabbit(100352815) molybdenum cofactor synthesis 3
sheep(101123226) molybdenum cofactor synthesis 3
Zebrafish(393095) molybdenum cofactor synthesis 3
domestic cat(101098618) molybdenum cofactor synthesis 3
cow(539728) molybdenum cofactor synthesis 3
dog(485928) molybdenum cofactor synthesis 3
chicken(769390) molybdenum cofactor synthesis 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001160330 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001160330 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001160330 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014484 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122221 MISSION® esiRNA esiRNA human MOCS3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014484 Rosetta Predictions human pricing
NM_001107804 Rosetta Predictions rat pricing
XM_130596 Rosetta Predictions mouse pricing
XM_911841 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058412 predicted 1265
2 SASI_Hs02_00345727 predicted 928
3 SASI_Hs02_00345728 predicted 1012
4 SASI_Hs01_00058414 predicted 1377
5 SASI_Hs01_00058415 predicted 1277
6 SASI_Hs02_00345729 predicted 1010
7 SASI_Hs02_00345730 predicted 850
8 SASI_Hs02_00345731 predicted 930
9 SASI_Hs02_00345732 predicted 961
10 SASI_Hs01_00058418 predicted 1062
11 SASI_Hs01_00058411 predicted 635
12 SASI_Hs01_00058413 predicted 568
13 SASI_Hs01_00058416 predicted 529
14 SASI_Hs01_00058417 predicted 677
15 SASI_Hs01_00058419 predicted 575
16 SASI_Hs01_00058420 predicted 1303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232435 predicted 1565
2 SASI_Rn02_00232436 predicted 636
3 SASI_Rn02_00232437 predicted 1302
4 SASI_Rn02_00232438 predicted 1304
5 SASI_Rn02_00232439 predicted 1677
6 SASI_Rn02_00232440 predicted 1461
7 SASI_Rn02_00232441 predicted 1538
8 SASI_Rn02_00232442 predicted 1683
9 SASI_Rn02_00232443 predicted 1553
10 SASI_Rn02_00232444 predicted 1396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424363 predicted 518
2 SASI_Mm02_00424364 predicted 1230
3 SASI_Mm02_00424365 predicted 1011
4 SASI_Mm02_00424366 predicted 1128
5 SASI_Mm02_00424367 predicted 1257
6 SASI_Mm02_00424368 predicted 638
7 SASI_Mm02_00424369 predicted 443
8 SASI_Mm02_00424370 predicted 711
9 SASI_Mm02_00424371 predicted 1108
10 SASI_Mm02_00424372 predicted 828
11 SASI_Mm01_00230520 predicted 212
12 SASI_Mm01_00230521 predicted 359
13 SASI_Mm01_00230522 predicted 346
14 SASI_Mm01_00230523 predicted 1603
15 SASI_Mm01_00230524 predicted 1795
16 SASI_Mm01_00230525 predicted 1849
17 SASI_Mm01_00230526 predicted 1483
18 SASI_Mm01_00230527 predicted 1314
19 SASI_Mm01_00230528 predicted 1650
20 SASI_Mm01_00230529 predicted 1383
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911841 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436668 predicted 518
2 SASI_Mm02_00436669 predicted 1232
3 SASI_Mm02_00436670 predicted 1010
4 SASI_Mm02_00436671 predicted 1128
5 SASI_Mm02_00436672 predicted 1261
6 SASI_Mm02_00436673 predicted 632
7 SASI_Mm02_00436674 predicted 447
8 SASI_Mm02_00436675 predicted 710
9 SASI_Mm02_00436676 predicted 1111
10 SASI_Mm02_00436677 predicted 823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001160330
MOCS3 MISSION shRNA Bacterial Glycerol Stock
molybdenum cofactor synthesis 3
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000346589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160330.1-1485s21c1
Sequence:CCGGATTCACGGTCTCCGAATAAATCTCGAGATTTATTCGGAGACCGTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160330.1-1161s21c1
Sequence:CCGGCGGACAGCCTGAAACTCTTAGCTCGAGCTAAGAGTTTCAGGCTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160330.1-1227s21c1
Sequence:CCGGCTCTCCCGGTGTATGTGATTTCTCGAGAAATCACATACACCGGGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001160330
MOCS3 MISSION shRNA shRNA Plasmid DNA
molybdenum cofactor synthesis 3
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000346589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160330.1-1485s21c1
Sequence:CCGGATTCACGGTCTCCGAATAAATCTCGAGATTTATTCGGAGACCGTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160330.1-1161s21c1
Sequence:CCGGCGGACAGCCTGAAACTCTTAGCTCGAGCTAAGAGTTTCAGGCTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160330.1-1227s21c1
Sequence:CCGGCTCTCCCGGTGTATGTGATTTCTCGAGAAATCACATACACCGGGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001160330
MOCS3 MISSION shRNA Lentiviral Transduction Particles
molybdenum cofactor synthesis 3
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000346589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160330.1-1485s21c1
Sequence:CCGGATTCACGGTCTCCGAATAAATCTCGAGATTTATTCGGAGACCGTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160330.1-1161s21c1
Sequence:CCGGCGGACAGCCTGAAACTCTTAGCTCGAGCTAAGAGTTTCAGGCTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160330.1-1227s21c1
Sequence:CCGGCTCTCCCGGTGTATGTGATTTCTCGAGAAATCACATACACCGGGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014484
VALIDATED
MOCS3 MISSION shRNA Bacterial Glycerol Stock
molybdenum cofactor synthesis 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014484.3-1021s21c1
Sequence:CCGGGTGTTTCTGTCACCGACTATACTCGAGTATAGTCGGTGACAGAAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014484.3-677s21c1
Sequence:CCGGCCCTTGCTATCGCTGCATATTCTCGAGAATATGCAGCGATAGCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014484.3-648s21c1
Sequence:CCGGCAAATCACAGTCTACCATTATCTCGAGATAATGGTAGACTGTGATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014484.3-1426s21c1
Sequence:CCGGAGATGTGGATTGCCATAATACCTCGAGGTATTATGGCAATCCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014484.3-646s1c1
Sequence:CCGGGCCAAATCACAGTCTACCATTCTCGAGAATGGTAGACTGTGATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014484.3-187s1c1
Sequence:CCGGGAGATGAGATTCTGCGCTATACTCGAGTATAGCGCAGAATCTCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014484.3-1308s1c1
Sequence:CCGGGCTCAAGAGTTAGACCCTTTACTCGAGTAAAGGGTCTAACTCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014484.3-677s1c1
Sequence:CCGGCCCTTGCTATCGCTGCATATTCTCGAGAATATGCAGCGATAGCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014484.3-861s21c1
Sequence:CCGGAGAGGGCATTTCCGCTCTATTCTCGAGAATAGAGCGGAAATGCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014484.3-1020s1c1
Sequence:CCGGCGTGTTTCTGTCACCGACTATCTCGAGATAGTCGGTGACAGAAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014484
VALIDATED
MOCS3 MISSION shRNA shRNA Plasmid DNA
molybdenum cofactor synthesis 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014484.3-1021s21c1
Sequence:CCGGGTGTTTCTGTCACCGACTATACTCGAGTATAGTCGGTGACAGAAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014484.3-677s21c1
Sequence:CCGGCCCTTGCTATCGCTGCATATTCTCGAGAATATGCAGCGATAGCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014484.3-648s21c1
Sequence:CCGGCAAATCACAGTCTACCATTATCTCGAGATAATGGTAGACTGTGATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014484.3-1426s21c1
Sequence:CCGGAGATGTGGATTGCCATAATACCTCGAGGTATTATGGCAATCCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014484.3-646s1c1
Sequence:CCGGGCCAAATCACAGTCTACCATTCTCGAGAATGGTAGACTGTGATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014484.3-187s1c1
Sequence:CCGGGAGATGAGATTCTGCGCTATACTCGAGTATAGCGCAGAATCTCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014484.3-1308s1c1
Sequence:CCGGGCTCAAGAGTTAGACCCTTTACTCGAGTAAAGGGTCTAACTCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014484.3-677s1c1
Sequence:CCGGCCCTTGCTATCGCTGCATATTCTCGAGAATATGCAGCGATAGCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014484.3-861s21c1
Sequence:CCGGAGAGGGCATTTCCGCTCTATTCTCGAGAATAGAGCGGAAATGCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014484.3-1020s1c1
Sequence:CCGGCGTGTTTCTGTCACCGACTATCTCGAGATAGTCGGTGACAGAAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014484
VALIDATED
MOCS3 MISSION shRNA Lentiviral Transduction Particles
molybdenum cofactor synthesis 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014484.3-1021s21c1
Sequence:CCGGGTGTTTCTGTCACCGACTATACTCGAGTATAGTCGGTGACAGAAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014484.3-677s21c1
Sequence:CCGGCCCTTGCTATCGCTGCATATTCTCGAGAATATGCAGCGATAGCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014484.3-648s21c1
Sequence:CCGGCAAATCACAGTCTACCATTATCTCGAGATAATGGTAGACTGTGATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014484.3-1426s21c1
Sequence:CCGGAGATGTGGATTGCCATAATACCTCGAGGTATTATGGCAATCCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014484.3-646s1c1
Sequence:CCGGGCCAAATCACAGTCTACCATTCTCGAGAATGGTAGACTGTGATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014484.3-187s1c1
Sequence:CCGGGAGATGAGATTCTGCGCTATACTCGAGTATAGCGCAGAATCTCATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014484.3-1308s1c1
Sequence:CCGGGCTCAAGAGTTAGACCCTTTACTCGAGTAAAGGGTCTAACTCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014484.3-677s1c1
Sequence:CCGGCCCTTGCTATCGCTGCATATTCTCGAGAATATGCAGCGATAGCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014484.3-861s21c1
Sequence:CCGGAGAGGGCATTTCCGCTCTATTCTCGAGAATAGAGCGGAAATGCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014484.3-1020s1c1
Sequence:CCGGCGTGTTTCTGTCACCGACTATCTCGAGATAGTCGGTGACAGAAACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)