EMAIL THIS PAGE TO A FRIEND

MOG

myelin oligodendrocyte glycoprotein

224 Gene Product Result for
Synonyms: MOGIG2 NRCLP7
Gene ID:
Human(4340) Summary: The product of this gene is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. This protein may be involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(17441) myelin oligodendrocyte glycoprotein
Rat(24558) myelin oligodendrocyte glycoprotein
sheep(101113019) myelin oligodendrocyte glycoprotein
naked mole-rat(101717855) myelin oligodendrocyte glycoprotein
domestic guinea pig(100714985) myelin oligodendrocyte glycoprotein
dog(488341) myelin oligodendrocyte glycoprotein
cow(280863) myelin oligodendrocyte glycoprotein
domestic cat(101099378) myelin oligodendrocyte glycoprotein
chicken(421050) myelin oligodendrocyte glycoprotein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002433 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008228 Rosetta Predictions human pricing
NM_001008229 Rosetta Predictions human pricing
NM_002433 Rosetta Predictions human pricing
NM_206809 Rosetta Predictions human pricing
NM_206810 Rosetta Predictions human pricing
NM_206811 Rosetta Predictions human pricing
NM_206812 Rosetta Predictions human pricing
NM_206813 Rosetta Predictions human pricing
NM_206814 Rosetta Predictions human pricing
NM_022668 Rosetta Predictions rat pricing
NM_010814 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125504 predicted 1346
2 SASI_Hs01_00125505 predicted 1343
3 SASI_Hs01_00125507 predicted 1295
4 SASI_Hs01_00125508 predicted 1335
5 SASI_Hs01_00125509 predicted 1292
6 SASI_Hs02_00305392 predicted 1343
7 SASI_Hs01_00125510 predicted 1294
8 SASI_Hs01_00125511 predicted 1014
9 SASI_Hs01_00125512 predicted 469
10 SASI_Hs01_00125513 predicted 920
11 SASI_Hs01_00125506 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181031 predicted 1028
2 SASI_Hs01_00181032 predicted 1025
3 SASI_Hs01_00181033 predicted 1075
4 SASI_Hs01_00181035 predicted 1087
5 SASI_Hs01_00181036 predicted 1082
6 SASI_Hs01_00181037 predicted 974
7 SASI_Hs01_00181038 predicted 1023
8 SASI_Hs01_00181039 predicted 1102
9 SASI_Hs01_00181040 predicted 976
10 SASI_Hs02_00305393 predicted 1026
11 SASI_Hs01_00181034 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101076 predicted 1162
2 SASI_Hs01_00101077 predicted 1156
3 SASI_Hs01_00101078 predicted 1216
4 SASI_Hs01_00101080 predicted 1229
5 SASI_Hs01_00101081 predicted 1215
6 SASI_Hs01_00101082 predicted 1112
7 SASI_Hs01_00101083 predicted 1153
8 SASI_Hs01_00101084 predicted 1238
9 SASI_Hs01_00101085 predicted 1115
10 SASI_Hs02_00333833 predicted 1164
11 SASI_Hs01_00101079 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152079 predicted 1415
2 SASI_Hs01_00152080 predicted 1407
3 SASI_Hs01_00152082 predicted 1357
4 SASI_Hs01_00152083 predicted 1409
5 SASI_Hs01_00152084 predicted 1357
6 SASI_Hs02_00373524 predicted 1412
7 SASI_Hs01_00152085 predicted 1356
8 SASI_Hs02_00373525 predicted 524
9 SASI_Hs01_00152086 predicted 803
10 SASI_Hs01_00152087 predicted 471
11 SASI_Hs01_00152081 predicted 1419
12 SASI_Hs01_00152088 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204628 predicted 1042
2 SASI_Hs01_00204629 predicted 1038
3 SASI_Hs01_00204630 predicted 1096
4 SASI_Hs01_00204632 predicted 1111
5 SASI_Hs01_00204633 predicted 1103
6 SASI_Hs01_00204634 predicted 993
7 SASI_Hs01_00204635 predicted 1044
8 SASI_Hs01_00204636 predicted 1126
9 SASI_Hs01_00204637 predicted 997
10 SASI_Hs02_00373526 predicted 1052
11 SASI_Hs01_00204631 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059316 predicted 1098
2 SASI_Hs01_00059317 predicted 1093
3 SASI_Hs01_00059318 predicted 1145
4 SASI_Hs01_00059320 predicted 1153
5 SASI_Hs01_00059321 predicted 1149
6 SASI_Hs01_00059322 predicted 1037
7 SASI_Hs01_00059323 predicted 1091
8 SASI_Hs01_00059324 predicted 1175
9 SASI_Hs01_00059325 predicted 1039
10 SASI_Hs02_00373527 predicted 1099
11 SASI_Hs01_00059319 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189058 predicted 1297
2 SASI_Hs01_00189059 predicted 1296
3 SASI_Hs01_00189061 predicted 1244
4 SASI_Hs01_00189062 predicted 1293
5 SASI_Hs01_00189063 predicted 1248
6 SASI_Hs02_00373528 predicted 1302
7 SASI_Hs01_00189064 predicted 1242
8 SASI_Hs01_00189065 predicted 969
9 SASI_Hs01_00189066 predicted 472
10 SASI_Hs01_00189067 predicted 873
11 SASI_Hs01_00189060 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373529 predicted 523
2 SASI_Hs01_00136854 predicted 947
3 SASI_Hs01_00136855 predicted 474
4 SASI_Hs01_00136856 predicted 317
5 SASI_Hs01_00136857 predicted 933
6 SASI_Hs01_00136858 predicted 1023
7 SASI_Hs01_00136859 predicted 516
8 SASI_Hs01_00136860 predicted 975
9 SASI_Hs01_00136861 predicted 475
10 SASI_Hs02_00373530 predicted 549
11 SASI_Hs01_00136862 predicted 1190
12 SASI_Hs01_00136863 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131457 predicted 946
2 SASI_Hs01_00131458 predicted 468
3 SASI_Hs01_00131459 predicted 1126
4 SASI_Hs01_00131460 predicted 321
5 SASI_Hs01_00131461 predicted 931
6 SASI_Hs01_00131462 predicted 1020
7 SASI_Hs01_00131463 predicted 1163
8 SASI_Hs01_00131464 predicted 519
9 SASI_Hs02_00373531 predicted 978
10 SASI_Hs01_00131465 predicted 483
11 SASI_Hs01_00131466 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022668 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040122 predicted 1074
2 SASI_Rn01_00040123 predicted 380
3 SASI_Rn01_00040124 predicted 901
4 SASI_Rn01_00040125 predicted 891
5 SASI_Rn01_00040128 predicted 249
6 SASI_Rn01_00040129 predicted 218
7 SASI_Rn01_00040130 predicted 1084
8 SASI_Rn01_00040131 predicted 553
9 SASI_Rn02_00263436 predicted 694
10 SASI_Rn02_00263437 predicted 452
11 SASI_Rn01_00040126 predicted 916
12 SASI_Rn01_00040127 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107138 predicted 498
2 SASI_Mm02_00319410 predicted 1046
3 SASI_Mm02_00319411 predicted 679
4 SASI_Mm01_00107140 predicted 621
5 SASI_Mm02_00319412 predicted 889
6 SASI_Mm02_00319413 predicted 897
7 SASI_Mm01_00107141 predicted 557
8 SASI_Mm01_00107143 predicted 523
9 SASI_Mm01_00107144 predicted 536
10 SASI_Mm02_00319414 predicted 1076
11 SASI_Mm01_00107139 predicted 284
12 SASI_Mm01_00107142 predicted 390
13 SASI_Mm01_00107145 predicted 307
14 SASI_Mm01_00107146 predicted 428
15 SASI_Mm01_00107147 predicted 409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010814
MOG MISSION shRNA Bacterial Glycerol Stock
myelin oligodendrocyte glycoprotein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010814.1-82s1c1
Sequence:CCGGGCAGGACAATTCAGAGTGATACTCGAGTATCACTCTGAATTGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010814.1-559s1c1
Sequence:CCGGGCAGAAGTAGAGAATCTCCATCTCGAGATGGAGATTCTCTACTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010814.1-238s1c1
Sequence:CCGGCGAAATGGCAAGGACCAAGATCTCGAGATCTTGGTCCTTGCCATTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010814.1-406s1c1
Sequence:CCGGGAGGCAGCAATGGAGTTGAAACTCGAGTTTCAACTCCATTGCTGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010814.1-61s1c1
Sequence:CCGGCTCCAGTTGTCATGCAGCTATCTCGAGATAGCTGCATGACAACTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010814
MOG MISSION shRNA shRNA Plasmid DNA
myelin oligodendrocyte glycoprotein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010814.1-82s1c1
Sequence:CCGGGCAGGACAATTCAGAGTGATACTCGAGTATCACTCTGAATTGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010814.1-559s1c1
Sequence:CCGGGCAGAAGTAGAGAATCTCCATCTCGAGATGGAGATTCTCTACTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010814.1-238s1c1
Sequence:CCGGCGAAATGGCAAGGACCAAGATCTCGAGATCTTGGTCCTTGCCATTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010814.1-406s1c1
Sequence:CCGGGAGGCAGCAATGGAGTTGAAACTCGAGTTTCAACTCCATTGCTGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010814.1-61s1c1
Sequence:CCGGCTCCAGTTGTCATGCAGCTATCTCGAGATAGCTGCATGACAACTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010814
MOG MISSION shRNA Lentiviral Transduction Particles
myelin oligodendrocyte glycoprotein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010814.1-82s1c1
Sequence:CCGGGCAGGACAATTCAGAGTGATACTCGAGTATCACTCTGAATTGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010814.1-559s1c1
Sequence:CCGGGCAGAAGTAGAGAATCTCCATCTCGAGATGGAGATTCTCTACTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010814.1-238s1c1
Sequence:CCGGCGAAATGGCAAGGACCAAGATCTCGAGATCTTGGTCCTTGCCATTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010814.1-406s1c1
Sequence:CCGGGAGGCAGCAATGGAGTTGAAACTCGAGTTTCAACTCCATTGCTGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010814.1-61s1c1
Sequence:CCGGCTCCAGTTGTCATGCAGCTATCTCGAGATAGCTGCATGACAACTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002433
MOG MISSION shRNA Bacterial Glycerol Stock
myelin oligodendrocyte glycoprotein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002433.2-873s1c1
Sequence:CCGGGCAATTCCTTGAAGAGCTACTCTCGAGAGTAGCTCTTCAAGGAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002433.2-549s1c1
Sequence:CCGGCCGAGATCATTCTTACCAAGACTCGAGTCTTGGTAAGAATGATCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002433.2-460s1c1
Sequence:CCGGCTGCTGAAAGATGCTATTGGTCTCGAGACCAATAGCATCTTTCAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002433.2-301s1c1
Sequence:CCGGGATGAAGTGGAATTGCCATGTCTCGAGACATGGCAATTCCACTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002433.3-1168s21c1
Sequence:CCGGTGAGCTGAAGAGTGAGGATATCTCGAGATATCCTCACTCTTCAGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002433.3-735s21c1
Sequence:CCGGTTCGAGCAGAGATAGAGAATCCTCGAGGATTCTCTATCTCTGCTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002433.3-1403s21c1
Sequence:CCGGTCAGAGTATCCACTGTTTATTCTCGAGAATAAACAGTGGATACTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002433.3-795s21c1
Sequence:CCGGGCTGGAAGATAACCCTGTTTGCTCGAGCAAACAGGGTTATCTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002433
MOG MISSION shRNA shRNA Plasmid DNA
myelin oligodendrocyte glycoprotein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002433.2-873s1c1
Sequence:CCGGGCAATTCCTTGAAGAGCTACTCTCGAGAGTAGCTCTTCAAGGAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002433.2-549s1c1
Sequence:CCGGCCGAGATCATTCTTACCAAGACTCGAGTCTTGGTAAGAATGATCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002433.2-460s1c1
Sequence:CCGGCTGCTGAAAGATGCTATTGGTCTCGAGACCAATAGCATCTTTCAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002433.2-301s1c1
Sequence:CCGGGATGAAGTGGAATTGCCATGTCTCGAGACATGGCAATTCCACTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002433.3-1168s21c1
Sequence:CCGGTGAGCTGAAGAGTGAGGATATCTCGAGATATCCTCACTCTTCAGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002433.3-735s21c1
Sequence:CCGGTTCGAGCAGAGATAGAGAATCCTCGAGGATTCTCTATCTCTGCTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002433.3-1403s21c1
Sequence:CCGGTCAGAGTATCCACTGTTTATTCTCGAGAATAAACAGTGGATACTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002433.3-795s21c1
Sequence:CCGGGCTGGAAGATAACCCTGTTTGCTCGAGCAAACAGGGTTATCTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002433
MOG MISSION shRNA Lentiviral Transduction Particles
myelin oligodendrocyte glycoprotein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002433.2-873s1c1
Sequence:CCGGGCAATTCCTTGAAGAGCTACTCTCGAGAGTAGCTCTTCAAGGAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002433.2-549s1c1
Sequence:CCGGCCGAGATCATTCTTACCAAGACTCGAGTCTTGGTAAGAATGATCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002433.2-460s1c1
Sequence:CCGGCTGCTGAAAGATGCTATTGGTCTCGAGACCAATAGCATCTTTCAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002433.2-301s1c1
Sequence:CCGGGATGAAGTGGAATTGCCATGTCTCGAGACATGGCAATTCCACTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002433.3-1168s21c1
Sequence:CCGGTGAGCTGAAGAGTGAGGATATCTCGAGATATCCTCACTCTTCAGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002433.3-735s21c1
Sequence:CCGGTTCGAGCAGAGATAGAGAATCCTCGAGGATTCTCTATCTCTGCTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002433.3-1403s21c1
Sequence:CCGGTCAGAGTATCCACTGTTTATTCTCGAGAATAAACAGTGGATACTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002433.3-795s21c1
Sequence:CCGGGCTGGAAGATAACCCTGTTTGCTCGAGCAAACAGGGTTATCTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)