EMAIL THIS PAGE TO A FRIEND

MOGAT1

monoacylglycerol O-acyltransferase 1

95 Gene Product Result for
Synonyms: DGAT2L DGAT2L1 MGAT1
UniProtKB ID: Q96PD6, Q6IEE5
Gene ID:
Human(116255) Summary: Acyl-CoA:monoacylglycerol acyltransferase (MOGAT; EC 2.3.1.22) catalyzes the synthesis of diacylglycerols, the precursor of physiologically important lipids such as triacylglycerol and phospholipids (Yen et al., 2002 [PubMed 12077311]
Mouse(68393) monoacylglycerol O-acyltransferase 1
Rat(363261) monoacylglycerol O-acyltransferase 1
chicken(424811) monoacylglycerol O-acyltransferase 1
dog(488548) monoacylglycerol O-acyltransferase 1
cow(407225) monoacylglycerol O-acyltransferase 1
domestic cat(101083285) monoacylglycerol O-acyltransferase 1
domestic guinea pig(100719476) monoacylglycerol O-acyltransferase 1
sheep(101116385) monoacylglycerol O-acyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058165 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058165 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058165 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026713 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026713 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026713 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058165 Rosetta Predictions human pricing
NM_001108803 Rosetta Predictions rat pricing
NM_026713 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238425 predicted 204
2 SASI_Hs01_00238426 predicted 527
3 SASI_Hs01_00238427 predicted 759
4 SASI_Hs01_00238428 predicted 217
5 SASI_Hs01_00238429 predicted 333
6 SASI_Hs01_00238430 predicted 645
7 SASI_Hs01_00238431 predicted 733
8 SASI_Hs01_00238432 predicted 575
9 SASI_Hs01_00238433 predicted 495
10 SASI_Hs01_00238434 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108803 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242225 predicted 344
2 SASI_Rn02_00242226 predicted 347
3 SASI_Rn02_00242227 predicted 343
4 SASI_Rn02_00242228 predicted 451
5 SASI_Rn02_00242229 predicted 272
6 SASI_Rn02_00242230 predicted 228
7 SASI_Rn02_00242231 predicted 357
8 SASI_Rn02_00242232 predicted 444
9 SASI_Rn02_00242233 predicted 403
10 SASI_Rn02_00242234 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026713 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177268 predicted 387
2 SASI_Mm01_00177269 predicted 719
3 SASI_Mm01_00177270 predicted 881
4 SASI_Mm01_00177271 predicted 351
5 SASI_Mm01_00177273 predicted 755
6 SASI_Mm01_00177274 predicted 527
7 SASI_Mm01_00177275 predicted 443
8 SASI_Mm01_00177276 predicted 462
9 SASI_Mm01_00177277 predicted 559
10 SASI_Mm02_00330745 predicted 801
11 SASI_Mm01_00177272 predicted 696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058165
MOGAT1 MISSION shRNA Bacterial Glycerol Stock
monoacylglycerol O-acyltransferase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058165.2-581s21c1
Sequence:CCGGGTGGAAACATCTCTGTCATTGCTCGAGCAATGACAGAGATGTTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058165.2-522s21c1
Sequence:CCGGTGTTGGGCTGGTTTCAGTTTCCTCGAGGAAACTGAAACCAGCCCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058165.2-282s21c1
Sequence:CCGGGACTCTTTGGAAACACTTTAACTCGAGTTAAAGTGTTTCCAAAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058165.2-393s21c1
Sequence:CCGGAGTTGGAGCCTTTGGGAATTTCTCGAGAAATTCCCAAAGGCTCCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058165.1-201s1c1
Sequence:CCGGCCCTTATTTGATGTGGCTTTACTCGAGTAAAGCCACATCAAATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058165.1-168s1c1
Sequence:CCGGGCTGATCATACACAACTATTTCTCGAGAAATAGTTGTGTATGATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058165.1-489s1c1
Sequence:CCGGGTGTCCTGTCTTTCGAGAATACTCGAGTATTCTCGAAAGACAGGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058165.1-445s1c1
Sequence:CCGGCCTGGCTTTACTTCATATCTTCTCGAGAAGATATGAAGTAAAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058165.1-659s1c1
Sequence:CCGGGCCAGCGGAAAGGATTTGTTACTCGAGTAACAAATCCTTTCCGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058165
MOGAT1 MISSION shRNA shRNA Plasmid DNA
monoacylglycerol O-acyltransferase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058165.2-581s21c1
Sequence:CCGGGTGGAAACATCTCTGTCATTGCTCGAGCAATGACAGAGATGTTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058165.2-522s21c1
Sequence:CCGGTGTTGGGCTGGTTTCAGTTTCCTCGAGGAAACTGAAACCAGCCCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058165.2-282s21c1
Sequence:CCGGGACTCTTTGGAAACACTTTAACTCGAGTTAAAGTGTTTCCAAAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058165.2-393s21c1
Sequence:CCGGAGTTGGAGCCTTTGGGAATTTCTCGAGAAATTCCCAAAGGCTCCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058165.1-201s1c1
Sequence:CCGGCCCTTATTTGATGTGGCTTTACTCGAGTAAAGCCACATCAAATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058165.1-168s1c1
Sequence:CCGGGCTGATCATACACAACTATTTCTCGAGAAATAGTTGTGTATGATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058165.1-489s1c1
Sequence:CCGGGTGTCCTGTCTTTCGAGAATACTCGAGTATTCTCGAAAGACAGGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058165.1-445s1c1
Sequence:CCGGCCTGGCTTTACTTCATATCTTCTCGAGAAGATATGAAGTAAAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058165.1-659s1c1
Sequence:CCGGGCCAGCGGAAAGGATTTGTTACTCGAGTAACAAATCCTTTCCGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058165
MOGAT1 MISSION shRNA Lentiviral Transduction Particles
monoacylglycerol O-acyltransferase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058165.2-581s21c1
Sequence:CCGGGTGGAAACATCTCTGTCATTGCTCGAGCAATGACAGAGATGTTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058165.2-522s21c1
Sequence:CCGGTGTTGGGCTGGTTTCAGTTTCCTCGAGGAAACTGAAACCAGCCCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058165.2-282s21c1
Sequence:CCGGGACTCTTTGGAAACACTTTAACTCGAGTTAAAGTGTTTCCAAAGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058165.2-393s21c1
Sequence:CCGGAGTTGGAGCCTTTGGGAATTTCTCGAGAAATTCCCAAAGGCTCCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058165.1-201s1c1
Sequence:CCGGCCCTTATTTGATGTGGCTTTACTCGAGTAAAGCCACATCAAATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058165.1-168s1c1
Sequence:CCGGGCTGATCATACACAACTATTTCTCGAGAAATAGTTGTGTATGATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058165.1-489s1c1
Sequence:CCGGGTGTCCTGTCTTTCGAGAATACTCGAGTATTCTCGAAAGACAGGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058165.1-445s1c1
Sequence:CCGGCCTGGCTTTACTTCATATCTTCTCGAGAAGATATGAAGTAAAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058165.1-659s1c1
Sequence:CCGGGCCAGCGGAAAGGATTTGTTACTCGAGTAACAAATCCTTTCCGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026713
MOGAT1 MISSION shRNA Bacterial Glycerol Stock
monoacylglycerol O-acyltransferase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026713.2-451s21c1
Sequence:CCGGCAGACTTCAAGAAGCTATTTCCTCGAGGAAATAGCTTCTTGAAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026713.2-364s21c1
Sequence:CCGGTGGATCCGGGTCACAATTATACTCGAGTATAATTGTGACCCGGATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026713.2-816s1c1
Sequence:CCGGGACGCAATGTATGATTCAATGCTCGAGCATTGAATCATACATTGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026713.2-393s21c1
Sequence:CCGGTTTCACCCTCATGGAATATTCCTCGAGGAATATTCCATGAGGGTGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026713.2-168s21c1
Sequence:CCGGCAGGTGTGCATTGGAATTATGCTCGAGCATAATTCCAATGCACACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026713.2-515s21c1
Sequence:CCGGTTTCCCGTTGTTCCGAGAATACTCGAGTATTCTCGGAACAACGGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026713.1-450s1c1
Sequence:CCGGCTCAGACTTCAAGAAGCTATTCTCGAGAATAGCTTCTTGAAGTCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026713.1-727s1c1
Sequence:CCGGGCCAGTTTGGTTCCAGTATTTCTCGAGAAATACTGGAACCAAACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026713
MOGAT1 MISSION shRNA shRNA Plasmid DNA
monoacylglycerol O-acyltransferase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026713.2-451s21c1
Sequence:CCGGCAGACTTCAAGAAGCTATTTCCTCGAGGAAATAGCTTCTTGAAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026713.2-364s21c1
Sequence:CCGGTGGATCCGGGTCACAATTATACTCGAGTATAATTGTGACCCGGATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026713.2-816s1c1
Sequence:CCGGGACGCAATGTATGATTCAATGCTCGAGCATTGAATCATACATTGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026713.2-393s21c1
Sequence:CCGGTTTCACCCTCATGGAATATTCCTCGAGGAATATTCCATGAGGGTGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026713.2-168s21c1
Sequence:CCGGCAGGTGTGCATTGGAATTATGCTCGAGCATAATTCCAATGCACACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026713.2-515s21c1
Sequence:CCGGTTTCCCGTTGTTCCGAGAATACTCGAGTATTCTCGGAACAACGGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026713.1-450s1c1
Sequence:CCGGCTCAGACTTCAAGAAGCTATTCTCGAGAATAGCTTCTTGAAGTCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026713.1-727s1c1
Sequence:CCGGGCCAGTTTGGTTCCAGTATTTCTCGAGAAATACTGGAACCAAACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026713
MOGAT1 MISSION shRNA Lentiviral Transduction Particles
monoacylglycerol O-acyltransferase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026713.2-451s21c1
Sequence:CCGGCAGACTTCAAGAAGCTATTTCCTCGAGGAAATAGCTTCTTGAAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026713.2-364s21c1
Sequence:CCGGTGGATCCGGGTCACAATTATACTCGAGTATAATTGTGACCCGGATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026713.2-816s1c1
Sequence:CCGGGACGCAATGTATGATTCAATGCTCGAGCATTGAATCATACATTGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026713.2-393s21c1
Sequence:CCGGTTTCACCCTCATGGAATATTCCTCGAGGAATATTCCATGAGGGTGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026713.2-168s21c1
Sequence:CCGGCAGGTGTGCATTGGAATTATGCTCGAGCATAATTCCAATGCACACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026713.2-515s21c1
Sequence:CCGGTTTCCCGTTGTTCCGAGAATACTCGAGTATTCTCGGAACAACGGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026713.1-450s1c1
Sequence:CCGGCTCAGACTTCAAGAAGCTATTCTCGAGAATAGCTTCTTGAAGTCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026713.1-727s1c1
Sequence:CCGGGCCAGTTTGGTTCCAGTATTTCTCGAGAAATACTGGAACCAAACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)