EMAIL THIS PAGE TO A FRIEND

MOGAT2

monoacylglycerol O-acyltransferase 2

71 Gene Product Result for
Synonyms: DGAT2L5 MGAT2
UniProtKB ID: Q3SYC2, A8K7I3, Q3SYC1, Q6ZQZ2, Q86UH6, Q9H630
Gene ID:
Human(80168) Summary: Dietary fat absorption from the small intestine is facilitated by acyl-CoA:monoacylglycerol transferase (MOGAT; EC 2.3.1.22) and acyl-CoA:diacylglycerol acyltransferase (DGAT; see MIM 604900) activities. MOGAT catalyzes the joining of monoacylglycerol and fatty acyl-CoAs to form diacylglycerol (Yen and Farese, 2003 [PubMed 12621063]
Mouse(233549) monoacylglycerol O-acyltransferase 2
Rat(681211) monoacylglycerol O-acyltransferase 2
domestic guinea pig(100718944) monoacylglycerol O-acyltransferase 2
naked mole-rat(101699301) monoacylglycerol O-acyltransferase 2
Zebrafish(450063) monoacylglycerol O-acyltransferase 2
cow(614494) monoacylglycerol O-acyltransferase 2
cow(509658) monoacylglycerol O-acyltransferase 2
cow(407226) monoacylglycerol O-acyltransferase 2
domestic cat(101091142) monoacylglycerol O-acyltransferase 2
dog(485186) monoacylglycerol O-acyltransferase 2
chicken(426437) monoacylglycerol O-acyltransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177448 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177448 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177448 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025098 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025098 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025098 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123381 MISSION® esiRNA esiRNA human MOGAT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025098 Rosetta Predictions human pricing
NM_001109436 Rosetta Predictions rat pricing
NM_177448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055772 predicted 523
2 SASI_Hs01_00055774 predicted 595
3 SASI_Hs01_00055775 predicted 209
4 SASI_Hs01_00055776 predicted 485
5 SASI_Hs01_00055778 predicted 532
6 SASI_Hs02_00357794 predicted 596
7 SASI_Hs01_00055779 predicted 468
8 SASI_Hs01_00055780 predicted 221
9 SASI_Hs01_00055781 predicted 582
10 SASI_Hs02_00357795 predicted 730
11 SASI_Hs01_00055773 predicted 769
12 SASI_Hs01_00055777 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109436 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248387 predicted 223
2 SASI_Rn02_00248388 predicted 204
3 SASI_Rn02_00248389 predicted 397
4 SASI_Rn02_00248390 predicted 331
5 SASI_Rn02_00248391 predicted 261
6 SASI_Rn02_00248392 predicted 385
7 SASI_Rn02_00248393 predicted 394
8 SASI_Rn02_00248394 predicted 315
9 SASI_Rn02_00248395 predicted 255
10 SASI_Rn02_00248396 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105211 predicted 1481
2 SASI_Mm01_00105212 predicted 1184
3 SASI_Mm01_00105213 predicted 736
4 SASI_Mm01_00105214 predicted 1306
5 SASI_Mm01_00105215 predicted 280
6 SASI_Mm01_00105216 predicted 341
7 SASI_Mm01_00105217 predicted 1291
8 SASI_Mm01_00105218 predicted 1047
9 SASI_Mm02_00347641 predicted 1284
10 SASI_Mm01_00105220 predicted 1313
11 SASI_Mm01_00105219 predicted 586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177448
VALIDATED
MOGAT2 MISSION shRNA Bacterial Glycerol Stock
monoacylglycerol O-acyltransferase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177448.3-424s1c1
Sequence:CCGGGCACGGGCTTTACCTCGCTTTCTCGAGAAAGCGAGGTAAAGCCCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177448.3-288s1c1
Sequence:CCGGTGGAAGTACATGAAGGATTATCTCGAGATAATCCTTCATGTACTTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177448.3-169s1c1
Sequence:CCGGGCCTCCTATTCACAAGGTTCTCTCGAGAGAACCTTGTGAATAGGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177448.3-740s1c1
Sequence:CCGGCCTGTTCAACCAGGTTGAGAACTCGAGTTCTCAACCTGGTTGAACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177448.3-554s1c1
Sequence:CCGGCGATCACATTCTGTCCAGGAACTCGAGTTCCTGGACAGAATGTGATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177448.4-1505s21c1
Sequence:CCGGGGGTCCTCTGAGCTATGATACCTCGAGGTATCATAGCTCAGAGGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177448.4-420s21c1
Sequence:CCGGGCACGGGCTTTACCTCGCTTTCTCGAGAAAGCGAGGTAAAGCCCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177448.4-284s21c1
Sequence:CCGGTGGAAGTACATGAAGGATTATCTCGAGATAATCCTTCATGTACTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177448.4-165s21c1
Sequence:CCGGGCCTCCTATTCACAAGGTTCTCTCGAGAGAACCTTGTGAATAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177448
VALIDATED
MOGAT2 MISSION shRNA shRNA Plasmid DNA
monoacylglycerol O-acyltransferase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177448.3-424s1c1
Sequence:CCGGGCACGGGCTTTACCTCGCTTTCTCGAGAAAGCGAGGTAAAGCCCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177448.3-288s1c1
Sequence:CCGGTGGAAGTACATGAAGGATTATCTCGAGATAATCCTTCATGTACTTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177448.3-169s1c1
Sequence:CCGGGCCTCCTATTCACAAGGTTCTCTCGAGAGAACCTTGTGAATAGGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177448.3-740s1c1
Sequence:CCGGCCTGTTCAACCAGGTTGAGAACTCGAGTTCTCAACCTGGTTGAACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177448.3-554s1c1
Sequence:CCGGCGATCACATTCTGTCCAGGAACTCGAGTTCCTGGACAGAATGTGATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177448.4-1505s21c1
Sequence:CCGGGGGTCCTCTGAGCTATGATACCTCGAGGTATCATAGCTCAGAGGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177448.4-420s21c1
Sequence:CCGGGCACGGGCTTTACCTCGCTTTCTCGAGAAAGCGAGGTAAAGCCCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177448.4-284s21c1
Sequence:CCGGTGGAAGTACATGAAGGATTATCTCGAGATAATCCTTCATGTACTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177448.4-165s21c1
Sequence:CCGGGCCTCCTATTCACAAGGTTCTCTCGAGAGAACCTTGTGAATAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177448
VALIDATED
MOGAT2 MISSION shRNA Lentiviral Transduction Particles
monoacylglycerol O-acyltransferase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177448.3-424s1c1
Sequence:CCGGGCACGGGCTTTACCTCGCTTTCTCGAGAAAGCGAGGTAAAGCCCGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177448.3-288s1c1
Sequence:CCGGTGGAAGTACATGAAGGATTATCTCGAGATAATCCTTCATGTACTTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177448.3-169s1c1
Sequence:CCGGGCCTCCTATTCACAAGGTTCTCTCGAGAGAACCTTGTGAATAGGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177448.3-740s1c1
Sequence:CCGGCCTGTTCAACCAGGTTGAGAACTCGAGTTCTCAACCTGGTTGAACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177448.3-554s1c1
Sequence:CCGGCGATCACATTCTGTCCAGGAACTCGAGTTCCTGGACAGAATGTGATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177448.4-1505s21c1
Sequence:CCGGGGGTCCTCTGAGCTATGATACCTCGAGGTATCATAGCTCAGAGGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177448.4-420s21c1
Sequence:CCGGGCACGGGCTTTACCTCGCTTTCTCGAGAAAGCGAGGTAAAGCCCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177448.4-284s21c1
Sequence:CCGGTGGAAGTACATGAAGGATTATCTCGAGATAATCCTTCATGTACTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177448.4-165s21c1
Sequence:CCGGGCCTCCTATTCACAAGGTTCTCTCGAGAGAACCTTGTGAATAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025098
MOGAT2 MISSION shRNA Bacterial Glycerol Stock
monoacylglycerol O-acyltransferase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025098.2-119s1c1
Sequence:CCGGCCCTCCTGTTTACAAGATTCTCTCGAGAGAATCTTGTAAACAGGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025098.2-228s1c1
Sequence:CCGGCTGGACTATATGGAAGTACATCTCGAGATGTACTTCCATATAGTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025098.2-49s1c1
Sequence:CCGGACACTTGCTGTCCTACAGTTTCTCGAGAAACTGTAGGACAGCAAGTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025098.2-801s1c1
Sequence:CCGGCCAGTACAGCTTTGGTTTAATCTCGAGATTAAACCAAAGCTGTACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025098.2-684s1c1
Sequence:CCGGGAATGACCTATTTGACCAGATCTCGAGATCTGGTCAAATAGGTCATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025098.2-717s21c1
Sequence:CCGGTGGCTCCTGGTTACGCTATATCTCGAGATATAGCGTAACCAGGAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025098.2-533s21c1
Sequence:CCGGGAAACTTGCTGGGCATCATTGCTCGAGCAATGATGCCCAGCAAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025098.2-375s21c1
Sequence:CCGGCACAGGCTTCTCTTCGATCTTCTCGAGAAGATCGAAGAGAAGCCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025098
MOGAT2 MISSION shRNA shRNA Plasmid DNA
monoacylglycerol O-acyltransferase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025098.2-119s1c1
Sequence:CCGGCCCTCCTGTTTACAAGATTCTCTCGAGAGAATCTTGTAAACAGGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025098.2-228s1c1
Sequence:CCGGCTGGACTATATGGAAGTACATCTCGAGATGTACTTCCATATAGTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025098.2-49s1c1
Sequence:CCGGACACTTGCTGTCCTACAGTTTCTCGAGAAACTGTAGGACAGCAAGTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025098.2-801s1c1
Sequence:CCGGCCAGTACAGCTTTGGTTTAATCTCGAGATTAAACCAAAGCTGTACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025098.2-684s1c1
Sequence:CCGGGAATGACCTATTTGACCAGATCTCGAGATCTGGTCAAATAGGTCATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025098.2-717s21c1
Sequence:CCGGTGGCTCCTGGTTACGCTATATCTCGAGATATAGCGTAACCAGGAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025098.2-533s21c1
Sequence:CCGGGAAACTTGCTGGGCATCATTGCTCGAGCAATGATGCCCAGCAAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025098.2-375s21c1
Sequence:CCGGCACAGGCTTCTCTTCGATCTTCTCGAGAAGATCGAAGAGAAGCCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025098
MOGAT2 MISSION shRNA Lentiviral Transduction Particles
monoacylglycerol O-acyltransferase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025098.2-119s1c1
Sequence:CCGGCCCTCCTGTTTACAAGATTCTCTCGAGAGAATCTTGTAAACAGGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025098.2-228s1c1
Sequence:CCGGCTGGACTATATGGAAGTACATCTCGAGATGTACTTCCATATAGTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025098.2-49s1c1
Sequence:CCGGACACTTGCTGTCCTACAGTTTCTCGAGAAACTGTAGGACAGCAAGTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025098.2-801s1c1
Sequence:CCGGCCAGTACAGCTTTGGTTTAATCTCGAGATTAAACCAAAGCTGTACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025098.2-684s1c1
Sequence:CCGGGAATGACCTATTTGACCAGATCTCGAGATCTGGTCAAATAGGTCATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025098.2-717s21c1
Sequence:CCGGTGGCTCCTGGTTACGCTATATCTCGAGATATAGCGTAACCAGGAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025098.2-533s21c1
Sequence:CCGGGAAACTTGCTGGGCATCATTGCTCGAGCAATGATGCCCAGCAAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025098.2-375s21c1
Sequence:CCGGCACAGGCTTCTCTTCGATCTTCTCGAGAAGATCGAAGAGAAGCCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)