EMAIL THIS PAGE TO A FRIEND

MOGAT3

monoacylglycerol O-acyltransferase 3

21 Gene Product Result for
Synonyms: DC7 DGAT2L7 MGAT3
UniProtKB ID: Q86VF5, Q496A6, Q496A7, Q496A8, Q9UDW7
Gene ID:
Human(346606) Summary: Acyl-CoA:monoacylglycerol acyltransferase (MOGAT; EC 2.3.1.22) catalyzes the synthesis of diacylglycerol from 2-monoacylglycerol and fatty acyl-CoA (Cheng et al., 2003 [PubMed 12618427]
domestic cat(101089413) monoacylglycerol O-acyltransferase 3
dog(608245) monoacylglycerol O-acyltransferase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178176 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012791 MISSION® esiRNA esiRNA targeting human MOGAT3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178176 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027866 predicted 211
2 SASI_Hs01_00027867 predicted 414
3 SASI_Hs01_00027868 predicted 522
4 SASI_Hs01_00027869 predicted 941
5 SASI_Hs01_00027870 predicted 784
6 SASI_Hs01_00027871 predicted 346
7 SASI_Hs01_00027872 predicted 429
8 SASI_Hs01_00027873 predicted 419
9 SASI_Hs01_00027874 predicted 525
10 SASI_Hs01_00027875 predicted 206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178176
MOGAT3 MISSION shRNA Bacterial Glycerol Stock
monoacylglycerol O-acyltransferase 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178176.2-949s21c1
Sequence:CCGGGCTTCTCTCCTTGCATCTTCTCTCGAGAGAAGATGCAAGGAGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178176.2-1132s21c1
Sequence:CCGGTCTTCGAGGAGCACAAGGAAACTCGAGTTTCCTTGTGCTCCTCGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178176.2-1079s1c1
Sequence:CCGGCGAGGAGGAAGTCAATCACTACTCGAGTAGTGATTGACTTCCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178176.2-639s1c1
Sequence:CCGGCGCGACTACATCATGTCCTTTCTCGAGAAAGGACATGATGTAGTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178176.2-388s21c1
Sequence:CCGGGAAGGCGTTCGGAGTGGATAACTCGAGTTATCCACTCCGAACGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178176.2-244s1c1
Sequence:CCGGCCTACCAATATGTGCTCACTTCTCGAGAAGTGAGCACATATTGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178176.2-414s1c1
Sequence:CCGGCGGGCAATTTGGAGACAACTACTCGAGTAGTTGTCTCCAAATTGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178176.2-1254s1c1
Sequence:CCGGTGGACTCCATGCCTCCAATAACTCGAGTTATTGGAGGCATGGAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178176
MOGAT3 MISSION shRNA shRNA Plasmid DNA
monoacylglycerol O-acyltransferase 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178176.2-949s21c1
Sequence:CCGGGCTTCTCTCCTTGCATCTTCTCTCGAGAGAAGATGCAAGGAGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178176.2-1132s21c1
Sequence:CCGGTCTTCGAGGAGCACAAGGAAACTCGAGTTTCCTTGTGCTCCTCGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178176.2-1079s1c1
Sequence:CCGGCGAGGAGGAAGTCAATCACTACTCGAGTAGTGATTGACTTCCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178176.2-639s1c1
Sequence:CCGGCGCGACTACATCATGTCCTTTCTCGAGAAAGGACATGATGTAGTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178176.2-388s21c1
Sequence:CCGGGAAGGCGTTCGGAGTGGATAACTCGAGTTATCCACTCCGAACGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178176.2-244s1c1
Sequence:CCGGCCTACCAATATGTGCTCACTTCTCGAGAAGTGAGCACATATTGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178176.2-414s1c1
Sequence:CCGGCGGGCAATTTGGAGACAACTACTCGAGTAGTTGTCTCCAAATTGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178176.2-1254s1c1
Sequence:CCGGTGGACTCCATGCCTCCAATAACTCGAGTTATTGGAGGCATGGAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178176
MOGAT3 MISSION shRNA Lentiviral Transduction Particles
monoacylglycerol O-acyltransferase 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178176.2-949s21c1
Sequence:CCGGGCTTCTCTCCTTGCATCTTCTCTCGAGAGAAGATGCAAGGAGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178176.2-1132s21c1
Sequence:CCGGTCTTCGAGGAGCACAAGGAAACTCGAGTTTCCTTGTGCTCCTCGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178176.2-1079s1c1
Sequence:CCGGCGAGGAGGAAGTCAATCACTACTCGAGTAGTGATTGACTTCCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178176.2-639s1c1
Sequence:CCGGCGCGACTACATCATGTCCTTTCTCGAGAAAGGACATGATGTAGTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178176.2-388s21c1
Sequence:CCGGGAAGGCGTTCGGAGTGGATAACTCGAGTTATCCACTCCGAACGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178176.2-244s1c1
Sequence:CCGGCCTACCAATATGTGCTCACTTCTCGAGAAGTGAGCACATATTGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178176.2-414s1c1
Sequence:CCGGCGGGCAATTTGGAGACAACTACTCGAGTAGTTGTCTCCAAATTGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178176.2-1254s1c1
Sequence:CCGGTGGACTCCATGCCTCCAATAACTCGAGTTATTGGAGGCATGGAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)