EMAIL THIS PAGE TO A FRIEND

MOGS

mannosyl-oligosaccharide glucosidase

49 Gene Product Result for
Synonyms: CDG2B CWH41 DER7 GCS1
UniProtKB ID: Q13724, A8K938, F5H6D0, Q17RN9, Q8TCT5
Gene ID:
Human(7841) Summary: This gene encodes the first enzyme in the N-linked oligosaccharide processing pathway. The enzyme cleaves the distal alpha-1,2-linked glucose residue from the Glc(3)-Man(9)-GlcNAc(2) oligosaccharide precursor. This protein is located in the lumen of the endoplasmic reticulum. Defects in this gene are a cause of type IIb congenital disorder of glycosylation (CDGIIb). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(57377) mannosyl-oligosaccharide glucosidase
Zebrafish(567913) mannosyl-oligosaccharide glucosidase
cow(516155) mannosyl-oligosaccharide glucosidase
Horse(100069105) mannosyl-oligosaccharide glucosidase
domestic cat(101086221) mannosyl-oligosaccharide glucosidase
dog(483104) mannosyl-oligosaccharide glucosidase
naked mole-rat(101699668) mannosyl-oligosaccharide glucosidase
domestic guinea pig(100736016) mannosyl-oligosaccharide glucosidase
sheep(101118003) mannosyl-oligosaccharide glucosidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020619 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020619 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020619 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006302 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006302 Rosetta Predictions human pricing
NM_020619 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341317 predicted 869
2 SASI_Hs01_00113064 predicted 980
3 SASI_Hs01_00113065 predicted 648
4 SASI_Hs02_00341318 predicted 2567
5 SASI_Hs01_00113066 predicted 2500
6 SASI_Hs01_00113067 predicted 1857
7 SASI_Hs01_00113068 predicted 970
8 SASI_Hs02_00341319 predicted 1652
9 SASI_Hs01_00113069 predicted 1001
10 SASI_Hs01_00113070 predicted 593
11 SASI_Hs01_00113071 predicted 844
12 SASI_Hs01_00113072 predicted 1474
13 SASI_Hs01_00113073 predicted 1724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020619 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136076 predicted 2456
2 SASI_Mm02_00325743 predicted 610
3 SASI_Mm01_00136077 predicted 562
4 SASI_Mm01_00136078 predicted 1643
5 SASI_Mm01_00136079 predicted 2414
6 SASI_Mm01_00136080 predicted 1178
7 SASI_Mm02_00325744 predicted 1286
8 SASI_Mm01_00136081 predicted 903
9 SASI_Mm01_00136083 predicted 1012
10 SASI_Mm01_00136084 predicted 1414
11 SASI_Mm01_00136082 predicted 833
12 SASI_Mm01_00136085 predicted 1630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020619
VALIDATED
MOGS MISSION shRNA Bacterial Glycerol Stock
mannosyl-oligosaccharide glucosidase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020619.2-2596s1c1
Sequence:CCGGGCTAGGCCATTTGTGTCACTTCTCGAGAAGTGACACAAATGGCCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020619.2-2404s1c1
Sequence:CCGGGCTGCCAAACTCTACCATGAACTCGAGTTCATGGTAGAGTTTGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020619.2-1618s1c1
Sequence:CCGGCCAGTCGTACACATGCTAGAACTCGAGTTCTAGCATGTGTACGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020619.2-2107s1c1
Sequence:CCGGCCTCGATTACAGTATGTGGATCTCGAGATCCACATACTGTAATCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020619.2-1162s21c1
Sequence:CCGGGCAGCCTTCAAGGAACGGTTTCTCGAGAAACCGTTCCTTGAAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020619.2-1162s1c1
Sequence:CCGGGCAGCCTTCAAGGAACGGTTTCTCGAGAAACCGTTCCTTGAAGGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020619.2-1767s21c1
Sequence:CCGGAGCTTTGCCTACCCTACTTAACTCGAGTTAAGTAGGGTAGGCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020619.2-2458s21c1
Sequence:CCGGCAATACCAGGCTACCGGATTTCTCGAGAAATCCGGTAGCCTGGTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020619.2-2596s21c1
Sequence:CCGGGCTAGGCCATTTGTGTCACTTCTCGAGAAGTGACACAAATGGCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020619.2-363s21c1
Sequence:CCGGCTACCGCCCACACGTCTATTTCTCGAGAAATAGACGTGTGGGCGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020619
VALIDATED
MOGS MISSION shRNA shRNA Plasmid DNA
mannosyl-oligosaccharide glucosidase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020619.2-2596s1c1
Sequence:CCGGGCTAGGCCATTTGTGTCACTTCTCGAGAAGTGACACAAATGGCCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020619.2-2404s1c1
Sequence:CCGGGCTGCCAAACTCTACCATGAACTCGAGTTCATGGTAGAGTTTGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020619.2-1618s1c1
Sequence:CCGGCCAGTCGTACACATGCTAGAACTCGAGTTCTAGCATGTGTACGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020619.2-2107s1c1
Sequence:CCGGCCTCGATTACAGTATGTGGATCTCGAGATCCACATACTGTAATCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020619.2-1162s21c1
Sequence:CCGGGCAGCCTTCAAGGAACGGTTTCTCGAGAAACCGTTCCTTGAAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020619.2-1162s1c1
Sequence:CCGGGCAGCCTTCAAGGAACGGTTTCTCGAGAAACCGTTCCTTGAAGGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020619.2-1767s21c1
Sequence:CCGGAGCTTTGCCTACCCTACTTAACTCGAGTTAAGTAGGGTAGGCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020619.2-2458s21c1
Sequence:CCGGCAATACCAGGCTACCGGATTTCTCGAGAAATCCGGTAGCCTGGTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020619.2-2596s21c1
Sequence:CCGGGCTAGGCCATTTGTGTCACTTCTCGAGAAGTGACACAAATGGCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020619.2-363s21c1
Sequence:CCGGCTACCGCCCACACGTCTATTTCTCGAGAAATAGACGTGTGGGCGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020619
VALIDATED
MOGS MISSION shRNA Lentiviral Transduction Particles
mannosyl-oligosaccharide glucosidase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020619.2-2596s1c1
Sequence:CCGGGCTAGGCCATTTGTGTCACTTCTCGAGAAGTGACACAAATGGCCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020619.2-2404s1c1
Sequence:CCGGGCTGCCAAACTCTACCATGAACTCGAGTTCATGGTAGAGTTTGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020619.2-1618s1c1
Sequence:CCGGCCAGTCGTACACATGCTAGAACTCGAGTTCTAGCATGTGTACGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020619.2-2107s1c1
Sequence:CCGGCCTCGATTACAGTATGTGGATCTCGAGATCCACATACTGTAATCGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020619.2-1162s21c1
Sequence:CCGGGCAGCCTTCAAGGAACGGTTTCTCGAGAAACCGTTCCTTGAAGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020619.2-1162s1c1
Sequence:CCGGGCAGCCTTCAAGGAACGGTTTCTCGAGAAACCGTTCCTTGAAGGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020619.2-1767s21c1
Sequence:CCGGAGCTTTGCCTACCCTACTTAACTCGAGTTAAGTAGGGTAGGCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020619.2-2458s21c1
Sequence:CCGGCAATACCAGGCTACCGGATTTCTCGAGAAATCCGGTAGCCTGGTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020619.2-2596s21c1
Sequence:CCGGGCTAGGCCATTTGTGTCACTTCTCGAGAAGTGACACAAATGGCCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020619.2-363s21c1
Sequence:CCGGCTACCGCCCACACGTCTATTTCTCGAGAAATAGACGTGTGGGCGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006302
VALIDATED
MOGS MISSION shRNA Bacterial Glycerol Stock
mannosyl-oligosaccharide glucosidase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006302.2-871s21c1
Sequence:CCGGACTTGGTGACTTCCGCTTTACCTCGAGGTAAAGCGGAAGTCACCAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006302.2-2696s21c1
Sequence:CCGGAGCCAAGACACTCATGCCACTCTCGAGAGTGGCATGAGTGTCTTGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_006302.1-2498s1c1
Sequence:CCGGCCAACGTGGTAGGCAATGTATCTCGAGATACATTGCCTACCACGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_006302.1-2076s1c1
Sequence:CCGGGCTAGGAGTCTTTGCAGACTTCTCGAGAAGTCTGCAAAGACTCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_006302.1-957s1c1
Sequence:CCGGGATGGTAAAGAGTCGCCTAAACTCGAGTTTAGGCGACTCTTTACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006302.2-2723s21c1
Sequence:CCGGCTGAAGGGACAAAGGCTTCTGCTCGAGCAGAAGCCTTTGTCCCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006302.2-1249s21c1
Sequence:CCGGGAGCCATGCTGAAGGCTTTAGCTCGAGCTAAAGCCTTCAGCATGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006302
VALIDATED
MOGS MISSION shRNA shRNA Plasmid DNA
mannosyl-oligosaccharide glucosidase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006302.2-871s21c1
Sequence:CCGGACTTGGTGACTTCCGCTTTACCTCGAGGTAAAGCGGAAGTCACCAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006302.2-2696s21c1
Sequence:CCGGAGCCAAGACACTCATGCCACTCTCGAGAGTGGCATGAGTGTCTTGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_006302.1-2498s1c1
Sequence:CCGGCCAACGTGGTAGGCAATGTATCTCGAGATACATTGCCTACCACGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_006302.1-2076s1c1
Sequence:CCGGGCTAGGAGTCTTTGCAGACTTCTCGAGAAGTCTGCAAAGACTCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_006302.1-957s1c1
Sequence:CCGGGATGGTAAAGAGTCGCCTAAACTCGAGTTTAGGCGACTCTTTACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006302.2-2723s21c1
Sequence:CCGGCTGAAGGGACAAAGGCTTCTGCTCGAGCAGAAGCCTTTGTCCCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006302.2-1249s21c1
Sequence:CCGGGAGCCATGCTGAAGGCTTTAGCTCGAGCTAAAGCCTTCAGCATGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006302
VALIDATED
MOGS MISSION shRNA Lentiviral Transduction Particles
mannosyl-oligosaccharide glucosidase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006302.2-871s21c1
Sequence:CCGGACTTGGTGACTTCCGCTTTACCTCGAGGTAAAGCGGAAGTCACCAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006302.2-2696s21c1
Sequence:CCGGAGCCAAGACACTCATGCCACTCTCGAGAGTGGCATGAGTGTCTTGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_006302.1-2498s1c1
Sequence:CCGGCCAACGTGGTAGGCAATGTATCTCGAGATACATTGCCTACCACGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_006302.1-2076s1c1
Sequence:CCGGGCTAGGAGTCTTTGCAGACTTCTCGAGAAGTCTGCAAAGACTCCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_006302.1-957s1c1
Sequence:CCGGGATGGTAAAGAGTCGCCTAAACTCGAGTTTAGGCGACTCTTTACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006302.2-2723s21c1
Sequence:CCGGCTGAAGGGACAAAGGCTTCTGCTCGAGCAGAAGCCTTTGTCCCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006302.2-1249s21c1
Sequence:CCGGGAGCCATGCTGAAGGCTTTAGCTCGAGCTAAAGCCTTCAGCATGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)