EMAIL THIS PAGE TO A FRIEND

MOK

MOK protein kinase

54 Gene Product Result for
Synonyms: RAGE RAGE-1 RAGE1
UniProtKB ID: Q9UQ07, Q92790, Q93067
Gene ID:
Human(5891) Summary: This gene belongs to the MAP kinase superfamily. The gene was found to be regulated by caudal type transcription factor 2 (Cdx2) protein. The encoded protein, which is localized to epithelial cells in the intestinal crypt, may play a role in growth arrest and differentiation of cells of upper crypt and lower villus regions. Multiple alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]
Rat(362787) MOK protein kinase
chicken(428910) MOK protein kinase
cow(616277) MOK protein kinase
domestic cat(101082831) MOK protein kinase
dog(490863) MOK protein kinase
sheep(101120444) MOK protein kinase
domestic guinea pig(100720304) MOK protein kinase
naked mole-rat(101700466) MOK protein kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0577 Canine MOK ELISA Kit canine pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014226 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014226 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014226 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123971 MISSION® esiRNA esiRNA human RAGE (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014226 Rosetta Predictions human pricing
NM_001010965 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139293 predicted 736
2 SASI_Hs01_00139294 predicted 1494
3 SASI_Hs01_00139295 predicted 900
4 SASI_Hs01_00139296 predicted 1273
5 SASI_Hs01_00139297 predicted 1157
6 SASI_Hs01_00139298 predicted 1262
7 SASI_Hs01_00139299 predicted 1296
8 SASI_Hs01_00139301 predicted 948
9 SASI_Hs01_00139302 predicted 1023
10 SASI_Hs02_00345254 predicted 287
11 SASI_Hs01_00139300 predicted 1667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054035 predicted 836
2 SASI_Rn01_00054037 predicted 812
3 SASI_Rn02_00199837 predicted 439
4 SASI_Rn01_00054038 predicted 519
5 SASI_Rn02_00199838 predicted 264
6 SASI_Rn01_00054039 predicted 379
7 SASI_Rn01_00054041 predicted 499
8 SASI_Rn01_00054042 predicted 327
9 SASI_Rn01_00054043 predicted 490
10 SASI_Rn02_00199839 predicted 826
11 SASI_Rn01_00054034 predicted 233
12 SASI_Rn01_00054036 predicted 416
13 SASI_Rn01_00054040 predicted 289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014226
MOK MISSION shRNA Bacterial Glycerol Stock
MOK protein kinase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.1-544s1c1
Sequence:CCGGGCACTATATGTACCAGTTATGCTCGAGCATAACTGGTACATATAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.1-506s1c1
Sequence:CCGGCGAGGGAGAAGATACCCATTACTCGAGTAATGGGTATCTTCTCCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.1-1295s1c1
Sequence:CCGGGTGGTCAGACTGTCGTCTTACCTCGAGGTAAGACGACAGTCTGACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.1-334s1c1
Sequence:CCGGGCAGCGCTTTGAAAGTATTGACTCGAGTCAATACTTTCAAAGCGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.x-450s1c1
Sequence:CCGGCTGGTTCTCTTGCACTAATATCTCGAGATATTAGTGCAAGAGAACCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014226.x-1674s1c1
Sequence:CCGGCTGGGCTAATATACTTGTAAACTCGAGTTTACAAGTATATTAGCCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.x-1402s1c1
Sequence:CCGGCAAGAAGACAGATCCGCAGAACTCGAGTTCTGCGGATCTGTCTTCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.x-790s1c1
Sequence:CCGGCGGCTGTGTGTTCTACGAGATCTCGAGATCTCGTAGAACACACAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014226
MOK MISSION shRNA shRNA Plasmid DNA
MOK protein kinase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.1-544s1c1
Sequence:CCGGGCACTATATGTACCAGTTATGCTCGAGCATAACTGGTACATATAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.1-506s1c1
Sequence:CCGGCGAGGGAGAAGATACCCATTACTCGAGTAATGGGTATCTTCTCCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.1-1295s1c1
Sequence:CCGGGTGGTCAGACTGTCGTCTTACCTCGAGGTAAGACGACAGTCTGACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.1-334s1c1
Sequence:CCGGGCAGCGCTTTGAAAGTATTGACTCGAGTCAATACTTTCAAAGCGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.x-450s1c1
Sequence:CCGGCTGGTTCTCTTGCACTAATATCTCGAGATATTAGTGCAAGAGAACCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014226.x-1674s1c1
Sequence:CCGGCTGGGCTAATATACTTGTAAACTCGAGTTTACAAGTATATTAGCCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.x-1402s1c1
Sequence:CCGGCAAGAAGACAGATCCGCAGAACTCGAGTTCTGCGGATCTGTCTTCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.x-790s1c1
Sequence:CCGGCGGCTGTGTGTTCTACGAGATCTCGAGATCTCGTAGAACACACAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014226
MOK MISSION shRNA Lentiviral Transduction Particles
MOK protein kinase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.1-544s1c1
Sequence:CCGGGCACTATATGTACCAGTTATGCTCGAGCATAACTGGTACATATAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.1-506s1c1
Sequence:CCGGCGAGGGAGAAGATACCCATTACTCGAGTAATGGGTATCTTCTCCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.1-1295s1c1
Sequence:CCGGGTGGTCAGACTGTCGTCTTACCTCGAGGTAAGACGACAGTCTGACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.1-334s1c1
Sequence:CCGGGCAGCGCTTTGAAAGTATTGACTCGAGTCAATACTTTCAAAGCGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.x-450s1c1
Sequence:CCGGCTGGTTCTCTTGCACTAATATCTCGAGATATTAGTGCAAGAGAACCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014226.x-1674s1c1
Sequence:CCGGCTGGGCTAATATACTTGTAAACTCGAGTTTACAAGTATATTAGCCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.x-1402s1c1
Sequence:CCGGCAAGAAGACAGATCCGCAGAACTCGAGTTCTGCGGATCTGTCTTCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014226.x-790s1c1
Sequence:CCGGCGGCTGTGTGTTCTACGAGATCTCGAGATCTCGTAGAACACACAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)