EMAIL THIS PAGE TO A FRIEND

MON1A

MON1 secretory trafficking family member A

61 Gene Product Result for
Synonyms: SAND1
UniProtKB ID: Q86VX9, B2RDQ1, G5E9N1, Q8NAV7, Q9BRF3
Gene ID:
Mouse(72825) MON1 homolog A (yeast)
Rat(315999) MON1 homolog A (yeast)
Zebrafish(100073333) MON1 homolog A (yeast)
Horse(100062456) MON1 homolog A (yeast)
cow(520286) MON1 homolog A (yeast)
domestic cat(101090423) MON1 homolog A (yeast)
chicken(415929) MON1 homolog A (yeast)
dog(476619) MON1 homolog A (yeast)
sheep(101123155) MON1 homolog A (yeast)
naked mole-rat(101722803) MON1 homolog A (yeast)
domestic guinea pig(100732692) MON1 homolog A (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028369 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028369 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028369 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032355 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032355 Rosetta Predictions human pricing
NM_001126284 Rosetta Predictions rat pricing
NM_028369 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019772 predicted 1008
2 SASI_Hs01_00019773 predicted 497
3 SASI_Hs01_00019774 predicted 1035
4 SASI_Hs01_00019775 predicted 514
5 SASI_Hs01_00019776 predicted 321
6 SASI_Hs01_00019777 predicted 1657
7 SASI_Hs01_00019778 predicted 243
8 SASI_Hs01_00019779 predicted 269
9 SASI_Hs01_00019780 predicted 489
10 SASI_Hs02_00359744 predicted 1764
11 SASI_Hs01_00019781 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126284 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253213 predicted 1700
2 SASI_Rn02_00253214 predicted 1104
3 SASI_Rn02_00253215 predicted 442
4 SASI_Rn02_00253216 predicted 986
5 SASI_Rn02_00253217 predicted 1215
6 SASI_Rn02_00253218 predicted 866
7 SASI_Rn02_00253219 predicted 1526
8 SASI_Rn02_00253220 predicted 568
9 SASI_Rn02_00253221 predicted 768
10 SASI_Rn02_00253222 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040924 predicted 1656
2 SASI_Mm01_00040925 predicted 384
3 SASI_Mm01_00040927 predicted 283
4 SASI_Mm01_00040928 predicted 1057
5 SASI_Mm01_00040929 predicted 510
6 SASI_Mm01_00040930 predicted 1573
7 SASI_Mm02_00333741 predicted 636
8 SASI_Mm01_00040931 predicted 1500
9 SASI_Mm01_00040932 predicted 1372
10 SASI_Mm01_00040933 predicted 1532
11 SASI_Mm01_00040926 predicted 1718
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028369
MON1A MISSION shRNA Bacterial Glycerol Stock
MON1 secretory trafficking family member A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028369.1-406s1c1
Sequence:CCGGGAAGACCTGACAGAGTTAGAACTCGAGTTCTAACTCTGTCAGGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028369.1-847s1c1
Sequence:CCGGGCAGATGGCTACAAGGTAGTACTCGAGTACTACCTTGTAGCCATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028369.1-1575s1c1
Sequence:CCGGCCACTTCCTCTATAAATCAAACTCGAGTTTGATTTATAGAGGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028369.2-1047s21c1
Sequence:CCGGTCGGAGCGAATCACCGATAACCTCGAGGTTATCGGTGATTCGCTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028369.2-484s21c1
Sequence:CCGGCTACGGACATGCGCCAGATTACTCGAGTAATCTGGCGCATGTCCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028369.2-1843s21c1
Sequence:CCGGTGATGCGCTGGATCCGTAAAGCTCGAGCTTTACGGATCCAGCGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028369.2-848s21c1
Sequence:CCGGAGATGGCTACAAGGTAGTATTCTCGAGAATACTACCTTGTAGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028369.2-1570s21c1
Sequence:CCGGTTCGCCACTTCCTCTATAAATCTCGAGATTTATAGAGGAAGTGGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028369
MON1A MISSION shRNA shRNA Plasmid DNA
MON1 secretory trafficking family member A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028369.1-406s1c1
Sequence:CCGGGAAGACCTGACAGAGTTAGAACTCGAGTTCTAACTCTGTCAGGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028369.1-847s1c1
Sequence:CCGGGCAGATGGCTACAAGGTAGTACTCGAGTACTACCTTGTAGCCATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028369.1-1575s1c1
Sequence:CCGGCCACTTCCTCTATAAATCAAACTCGAGTTTGATTTATAGAGGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028369.2-1047s21c1
Sequence:CCGGTCGGAGCGAATCACCGATAACCTCGAGGTTATCGGTGATTCGCTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028369.2-484s21c1
Sequence:CCGGCTACGGACATGCGCCAGATTACTCGAGTAATCTGGCGCATGTCCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028369.2-1843s21c1
Sequence:CCGGTGATGCGCTGGATCCGTAAAGCTCGAGCTTTACGGATCCAGCGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028369.2-848s21c1
Sequence:CCGGAGATGGCTACAAGGTAGTATTCTCGAGAATACTACCTTGTAGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028369.2-1570s21c1
Sequence:CCGGTTCGCCACTTCCTCTATAAATCTCGAGATTTATAGAGGAAGTGGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028369
MON1A MISSION shRNA Lentiviral Transduction Particles
MON1 secretory trafficking family member A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028369.1-406s1c1
Sequence:CCGGGAAGACCTGACAGAGTTAGAACTCGAGTTCTAACTCTGTCAGGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028369.1-847s1c1
Sequence:CCGGGCAGATGGCTACAAGGTAGTACTCGAGTACTACCTTGTAGCCATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028369.1-1575s1c1
Sequence:CCGGCCACTTCCTCTATAAATCAAACTCGAGTTTGATTTATAGAGGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028369.2-1047s21c1
Sequence:CCGGTCGGAGCGAATCACCGATAACCTCGAGGTTATCGGTGATTCGCTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028369.2-484s21c1
Sequence:CCGGCTACGGACATGCGCCAGATTACTCGAGTAATCTGGCGCATGTCCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028369.2-1843s21c1
Sequence:CCGGTGATGCGCTGGATCCGTAAAGCTCGAGCTTTACGGATCCAGCGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028369.2-848s21c1
Sequence:CCGGAGATGGCTACAAGGTAGTATTCTCGAGAATACTACCTTGTAGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028369.2-1570s21c1
Sequence:CCGGTTCGCCACTTCCTCTATAAATCTCGAGATTTATAGAGGAAGTGGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032355
VALIDATED
MON1A MISSION shRNA Bacterial Glycerol Stock
MON1 secretory trafficking family member A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032355.2-285s1c1
Sequence:CCGGCTCCTTCTGATGGACAGAGTACTCGAGTACTCTGTCCATCAGAAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032355.2-840s1c1
Sequence:CCGGCAGATGGCTACAAGGTAGTATCTCGAGATACTACCTTGTAGCCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032355.2-1705s1c1
Sequence:CCGGCCCACTCAAGACCATTTACTACTCGAGTAGTAAATGGTCTTGAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032355.2-1768s1c1
Sequence:CCGGCTTTGAGCTCTACATGTGTTACTCGAGTAACACATGTAGAGCTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032355.3-690s21c1
Sequence:CCGGCCAGGACTTTAGCGAGCTAAGCTCGAGCTTAGCTCGCTAAAGTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032355.3-1187s21c1
Sequence:CCGGAGCAGAAGCAGAACTATGATTCTCGAGAATCATAGTTCTGCTTCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032355.3-1125s21c1
Sequence:CCGGGCTCTACATCTACTACCAGATCTCGAGATCTGGTAGTAGATGTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032355.3-1756s21c1
Sequence:CCGGCACTTCCTCTATAAGTCAAAGCTCGAGCTTTGACTTATAGAGGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032355.3-451s21c1
Sequence:CCGGGAATGCCTTGATGGCACATTGCTCGAGCAATGTGCCATCAAGGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032355.3-2001s21c1
Sequence:CCGGAGCCGTCAGTGCCATCCATAACTCGAGTTATGGATGGCACTGACGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032355
VALIDATED
MON1A MISSION shRNA shRNA Plasmid DNA
MON1 secretory trafficking family member A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032355.2-285s1c1
Sequence:CCGGCTCCTTCTGATGGACAGAGTACTCGAGTACTCTGTCCATCAGAAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032355.2-840s1c1
Sequence:CCGGCAGATGGCTACAAGGTAGTATCTCGAGATACTACCTTGTAGCCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032355.2-1705s1c1
Sequence:CCGGCCCACTCAAGACCATTTACTACTCGAGTAGTAAATGGTCTTGAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032355.2-1768s1c1
Sequence:CCGGCTTTGAGCTCTACATGTGTTACTCGAGTAACACATGTAGAGCTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032355.3-690s21c1
Sequence:CCGGCCAGGACTTTAGCGAGCTAAGCTCGAGCTTAGCTCGCTAAAGTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032355.3-1187s21c1
Sequence:CCGGAGCAGAAGCAGAACTATGATTCTCGAGAATCATAGTTCTGCTTCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032355.3-1125s21c1
Sequence:CCGGGCTCTACATCTACTACCAGATCTCGAGATCTGGTAGTAGATGTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032355.3-1756s21c1
Sequence:CCGGCACTTCCTCTATAAGTCAAAGCTCGAGCTTTGACTTATAGAGGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032355.3-451s21c1
Sequence:CCGGGAATGCCTTGATGGCACATTGCTCGAGCAATGTGCCATCAAGGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032355.3-2001s21c1
Sequence:CCGGAGCCGTCAGTGCCATCCATAACTCGAGTTATGGATGGCACTGACGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032355
VALIDATED
MON1A MISSION shRNA Lentiviral Transduction Particles
MON1 secretory trafficking family member A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032355.2-285s1c1
Sequence:CCGGCTCCTTCTGATGGACAGAGTACTCGAGTACTCTGTCCATCAGAAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032355.2-840s1c1
Sequence:CCGGCAGATGGCTACAAGGTAGTATCTCGAGATACTACCTTGTAGCCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032355.2-1705s1c1
Sequence:CCGGCCCACTCAAGACCATTTACTACTCGAGTAGTAAATGGTCTTGAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032355.2-1768s1c1
Sequence:CCGGCTTTGAGCTCTACATGTGTTACTCGAGTAACACATGTAGAGCTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032355.3-690s21c1
Sequence:CCGGCCAGGACTTTAGCGAGCTAAGCTCGAGCTTAGCTCGCTAAAGTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032355.3-1187s21c1
Sequence:CCGGAGCAGAAGCAGAACTATGATTCTCGAGAATCATAGTTCTGCTTCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032355.3-1125s21c1
Sequence:CCGGGCTCTACATCTACTACCAGATCTCGAGATCTGGTAGTAGATGTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032355.3-1756s21c1
Sequence:CCGGCACTTCCTCTATAAGTCAAAGCTCGAGCTTTGACTTATAGAGGAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032355.3-451s21c1
Sequence:CCGGGAATGCCTTGATGGCACATTGCTCGAGCAATGTGCCATCAAGGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032355.3-2001s21c1
Sequence:CCGGAGCCGTCAGTGCCATCCATAACTCGAGTTATGGATGGCACTGACGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)