EMAIL THIS PAGE TO A FRIEND

MON1B

MON1 secretory trafficking family member B

95 Gene Product Result for
Synonyms: HSRG1 SAND2 SRG1
UniProtKB ID: Q7L1V2, O94949
Gene ID:
Mouse(270096) MON1 homolog b (yeast)
Rat(307868) MON1 homolog b (yeast)
domestic guinea pig(100723693) MON1 homolog B (yeast)
naked mole-rat(101701800) MON1 homolog B (yeast)
sheep(101118722) MON1 homolog B (yeast)
cow(510379) MON1 homolog B (yeast)
domestic cat(101092978) MON1 homolog B (yeast)
dog(489705) MON1 homolog B (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014940 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014940 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014940 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173015 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173015 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173015 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014940 Rosetta Predictions human pricing
NM_001107433 Rosetta Predictions rat pricing
NM_001048143 Rosetta Predictions mouse pricing
NM_173015 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177957 predicted 1949
2 SASI_Hs01_00177958 predicted 2374
3 SASI_Hs01_00177959 predicted 2067
4 SASI_Hs01_00177960 predicted 2072
5 SASI_Hs01_00177961 predicted 583
6 SASI_Hs01_00177962 predicted 1830
7 SASI_Hs01_00177963 predicted 1830
8 SASI_Hs01_00177964 predicted 1965
9 SASI_Hs01_00177965 predicted 956
10 SASI_Hs01_00177966 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107433 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228775 predicted 948
2 SASI_Rn02_00228776 predicted 1621
3 SASI_Rn02_00228777 predicted 545
4 SASI_Rn02_00228778 predicted 1724
5 SASI_Rn02_00228779 predicted 949
6 SASI_Rn02_00228780 predicted 1245
7 SASI_Rn02_00228781 predicted 594
8 SASI_Rn02_00228782 predicted 380
9 SASI_Rn02_00228783 predicted 543
10 SASI_Rn02_00228784 predicted 1463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292041 predicted 725
2 SASI_Mm02_00292042 predicted 1143
3 SASI_Mm02_00292043 predicted 1132
4 SASI_Mm02_00292044 predicted 1134
5 SASI_Mm02_00292045 predicted 775
6 SASI_Mm02_00292046 predicted 729
7 SASI_Mm02_00292047 predicted 612
8 SASI_Mm02_00292048 predicted 1382
9 SASI_Mm02_00292049 predicted 1646
10 SASI_Mm02_00292050 predicted 1433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062025 predicted 917
2 SASI_Mm02_00345074 predicted 1334
3 SASI_Mm01_00062026 predicted 1317
4 SASI_Mm02_00345075 predicted 1323
5 SASI_Mm01_00062027 predicted 972
6 SASI_Mm02_00345076 predicted 924
7 SASI_Mm01_00062028 predicted 798
8 SASI_Mm01_00062031 predicted 1574
9 SASI_Mm01_00062032 predicted 1835
10 SASI_Mm02_00345077 predicted 1625
11 SASI_Mm01_00062029 predicted 377
12 SASI_Mm01_00062030 predicted 1752
13 SASI_Mm01_00062033 predicted 1986
14 SASI_Mm01_00062034 predicted 1851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014940
VALIDATED
MON1B MISSION shRNA Bacterial Glycerol Stock
MON1 secretory trafficking family member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014940.2-2294s21c1
Sequence:CCGGGGTCTGCCTCCTAGTTGAATCCTCGAGGATTCAACTAGGAGGCAGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014940.2-2402s21c1
Sequence:CCGGGGGACTGGCCTGAGGGTATTTCTCGAGAAATACCCTCAGGCCAGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014940.2-915s21c1
Sequence:CCGGACAGATCGTGAGCACACTTACCTCGAGGTAAGTGTGCTCACGATCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014940.2-2074s21c1
Sequence:CCGGGTCATTGTCTCCCTAAGCAATCTCGAGATTGCTTAGGGAGACAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014940.2-1831s1c1
Sequence:CCGGGCAATCTTGGTAGTGACCAAACTCGAGTTTGGTCACTACCAAGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014940.2-811s1c1
Sequence:CCGGCACAAGCTGGTGTTCCTACAACTCGAGTTGTAGGAACACCAGCTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014940.2-1314s1c1
Sequence:CCGGCCGCTTCAACCCTGATGGTTTCTCGAGAAACCATCAGGGTTGAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014940.2-1776s1c1
Sequence:CCGGGACCTCCAAATTCGAGCTCTACTCGAGTAGAGCTCGAATTTGGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014940.2-572s1c1
Sequence:CCGGCTGAGAATAGTCCCACATGTACTCGAGTACATGTGGGACTATTCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014940
VALIDATED
MON1B MISSION shRNA shRNA Plasmid DNA
MON1 secretory trafficking family member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014940.2-2294s21c1
Sequence:CCGGGGTCTGCCTCCTAGTTGAATCCTCGAGGATTCAACTAGGAGGCAGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014940.2-2402s21c1
Sequence:CCGGGGGACTGGCCTGAGGGTATTTCTCGAGAAATACCCTCAGGCCAGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014940.2-915s21c1
Sequence:CCGGACAGATCGTGAGCACACTTACCTCGAGGTAAGTGTGCTCACGATCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014940.2-2074s21c1
Sequence:CCGGGTCATTGTCTCCCTAAGCAATCTCGAGATTGCTTAGGGAGACAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014940.2-1831s1c1
Sequence:CCGGGCAATCTTGGTAGTGACCAAACTCGAGTTTGGTCACTACCAAGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014940.2-811s1c1
Sequence:CCGGCACAAGCTGGTGTTCCTACAACTCGAGTTGTAGGAACACCAGCTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014940.2-1314s1c1
Sequence:CCGGCCGCTTCAACCCTGATGGTTTCTCGAGAAACCATCAGGGTTGAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014940.2-1776s1c1
Sequence:CCGGGACCTCCAAATTCGAGCTCTACTCGAGTAGAGCTCGAATTTGGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014940.2-572s1c1
Sequence:CCGGCTGAGAATAGTCCCACATGTACTCGAGTACATGTGGGACTATTCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014940
VALIDATED
MON1B MISSION shRNA Lentiviral Transduction Particles
MON1 secretory trafficking family member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014940.2-2294s21c1
Sequence:CCGGGGTCTGCCTCCTAGTTGAATCCTCGAGGATTCAACTAGGAGGCAGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014940.2-2402s21c1
Sequence:CCGGGGGACTGGCCTGAGGGTATTTCTCGAGAAATACCCTCAGGCCAGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014940.2-915s21c1
Sequence:CCGGACAGATCGTGAGCACACTTACCTCGAGGTAAGTGTGCTCACGATCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014940.2-2074s21c1
Sequence:CCGGGTCATTGTCTCCCTAAGCAATCTCGAGATTGCTTAGGGAGACAATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014940.2-1831s1c1
Sequence:CCGGGCAATCTTGGTAGTGACCAAACTCGAGTTTGGTCACTACCAAGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014940.2-811s1c1
Sequence:CCGGCACAAGCTGGTGTTCCTACAACTCGAGTTGTAGGAACACCAGCTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014940.2-1314s1c1
Sequence:CCGGCCGCTTCAACCCTGATGGTTTCTCGAGAAACCATCAGGGTTGAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014940.2-1776s1c1
Sequence:CCGGGACCTCCAAATTCGAGCTCTACTCGAGTAGAGCTCGAATTTGGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014940.2-572s1c1
Sequence:CCGGCTGAGAATAGTCCCACATGTACTCGAGTACATGTGGGACTATTCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173015
MON1B MISSION shRNA Bacterial Glycerol Stock
MON1 secretory trafficking family member B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173015.2-1177s21c1
Sequence:CCGGCTGTTGGCGGTCGACTGATAACTCGAGTTATCAGTCGACCGCCAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173015.2-912s21c1
Sequence:CCGGCTTGCTGTACACGCCCAAATTCTCGAGAATTTGGGCGTGTACAGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173015.2-3193s21c1
Sequence:CCGGCTTCGGCTCATTACGATAATTCTCGAGAATTATCGTAATGAGCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173015.2-1902s21c1
Sequence:CCGGATCCGTTACCCACCCAAATACCTCGAGGTATTTGGGTGGGTAACGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173015.2-970s21c1
Sequence:CCGGTCGCACATAAGCAGAACTATGCTCGAGCATAGTTCTGCTTATGTGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183490    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173015.1-2744s1c1
Sequence:CCGGGCATGAACATATTCTGGACATCTCGAGATGTCCAGAATATGTTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173015.1-937s1c1
Sequence:CCGGCGCACATAAGCAGAACTATGACTCGAGTCATAGTTCTGCTTATGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173015.1-1556s1c1
Sequence:CCGGCCACTGGATATCCCTGAACAACTCGAGTTGTTCAGGGATATCCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173015
MON1B MISSION shRNA shRNA Plasmid DNA
MON1 secretory trafficking family member B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173015.2-1177s21c1
Sequence:CCGGCTGTTGGCGGTCGACTGATAACTCGAGTTATCAGTCGACCGCCAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173015.2-912s21c1
Sequence:CCGGCTTGCTGTACACGCCCAAATTCTCGAGAATTTGGGCGTGTACAGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173015.2-3193s21c1
Sequence:CCGGCTTCGGCTCATTACGATAATTCTCGAGAATTATCGTAATGAGCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173015.2-1902s21c1
Sequence:CCGGATCCGTTACCCACCCAAATACCTCGAGGTATTTGGGTGGGTAACGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173015.2-970s21c1
Sequence:CCGGTCGCACATAAGCAGAACTATGCTCGAGCATAGTTCTGCTTATGTGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183490    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173015.1-2744s1c1
Sequence:CCGGGCATGAACATATTCTGGACATCTCGAGATGTCCAGAATATGTTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173015.1-937s1c1
Sequence:CCGGCGCACATAAGCAGAACTATGACTCGAGTCATAGTTCTGCTTATGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173015.1-1556s1c1
Sequence:CCGGCCACTGGATATCCCTGAACAACTCGAGTTGTTCAGGGATATCCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173015
MON1B MISSION shRNA Lentiviral Transduction Particles
MON1 secretory trafficking family member B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173015.2-1177s21c1
Sequence:CCGGCTGTTGGCGGTCGACTGATAACTCGAGTTATCAGTCGACCGCCAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173015.2-912s21c1
Sequence:CCGGCTTGCTGTACACGCCCAAATTCTCGAGAATTTGGGCGTGTACAGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173015.2-3193s21c1
Sequence:CCGGCTTCGGCTCATTACGATAATTCTCGAGAATTATCGTAATGAGCCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173015.2-1902s21c1
Sequence:CCGGATCCGTTACCCACCCAAATACCTCGAGGTATTTGGGTGGGTAACGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173015.2-970s21c1
Sequence:CCGGTCGCACATAAGCAGAACTATGCTCGAGCATAGTTCTGCTTATGTGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183490    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173015.1-2744s1c1
Sequence:CCGGGCATGAACATATTCTGGACATCTCGAGATGTCCAGAATATGTTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173015.1-937s1c1
Sequence:CCGGCGCACATAAGCAGAACTATGACTCGAGTCATAGTTCTGCTTATGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173015.1-1556s1c1
Sequence:CCGGCCACTGGATATCCCTGAACAACTCGAGTTGTTCAGGGATATCCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)