EMAIL THIS PAGE TO A FRIEND

MORC1

MORC family CW-type zinc finger 1

77 Gene Product Result for
Synonyms: CT33 MORC ZCW6
UniProtKB ID: Q86VD1, Q7L8E2, Q9NSG7, Q9Y6D4
Gene ID:
Human(27136) Summary: This gene encodes the human homolog of mouse morc and like the mouse protein it is testis-specific. Mouse studies support a testis-specific function since only male knockout mice are infertile; infertility is the only apparent defect. These studies further support a role for this protein early in spermatogenesis, possibly by affecting entry into apoptosis because testis from knockout mice show greatly increased numbers of apoptotic cells. [provided by RefSeq, Jan 2009]
Mouse(17450) microrchidia 1
Rat(360712) MORC family CW-type zinc finger 1
domestic cat(101084566) MORC family CW-type zinc finger 1
cow(521713) MORC family CW-type zinc finger 1
Horse(100071799) MORC family CW-type zinc finger 1
dog(478557) MORC family CW-type zinc finger 1
sheep(101112697) MORC family CW-type zinc finger 1
domestic guinea pig(100730273) MORC family CW-type zinc finger 1
naked mole-rat(101706157) MORC family CW-type zinc finger 1
Domestic Rabbit(100352688) MORC family CW-type zinc finger 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014429 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010816 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010816 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010816 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014429 Rosetta Predictions human pricing
XM_001064970 Rosetta Predictions rat pricing
XM_340983 Rosetta Predictions rat pricing
NM_010816 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233173 predicted 1370
2 SASI_Hs01_00233174 predicted 416
3 SASI_Hs01_00233175 predicted 2172
4 SASI_Hs01_00233176 predicted 1592
5 SASI_Hs02_00345634 predicted 514
6 SASI_Hs02_00345635 predicted 602
7 SASI_Hs01_00233177 predicted 1705
8 SASI_Hs01_00233178 predicted 636
9 SASI_Hs01_00233179 predicted 350
10 SASI_Hs02_00345636 predicted 2222
11 SASI_Hs01_00233171 predicted 820
12 SASI_Hs01_00233172 predicted 1113
13 SASI_Hs01_00233180 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312395 predicted 541
2 SASI_Rn02_00312396 predicted 965
3 SASI_Rn02_00312397 predicted 261
4 SASI_Rn02_00312398 predicted 1272
5 SASI_Rn02_00312399 predicted 899
6 SASI_Rn02_00312400 predicted 1091
7 SASI_Rn02_00312401 predicted 1183
8 SASI_Rn02_00312402 predicted 369
9 SASI_Rn02_00312403 predicted 1009
10 SASI_Rn02_00312404 predicted 1728
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392220 predicted 2589
2 SASI_Rn02_00392221 predicted 2589
3 SASI_Rn02_00392222 predicted 2553
4 SASI_Rn02_00392223 predicted 2580
5 SASI_Rn02_00392224 predicted 2483
6 SASI_Rn02_00392225 predicted 2514
7 SASI_Rn02_00392226 predicted 2483
8 SASI_Rn02_00392227 predicted 2490
9 SASI_Rn02_00392228 predicted 2411
10 SASI_Rn02_00392229 predicted 2519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031103 predicted 1284
2 SASI_Mm01_00031105 predicted 2305
3 SASI_Mm02_00319417 predicted 2530
4 SASI_Mm01_00031106 predicted 1996
5 SASI_Mm01_00031107 predicted 1614
6 SASI_Mm01_00031108 predicted 382
7 SASI_Mm01_00031109 predicted 1054
8 SASI_Mm01_00031110 predicted 1938
9 SASI_Mm02_00319418 predicted 796
10 SASI_Mm01_00031111 predicted 319
11 SASI_Mm01_00031104 predicted 1205
12 SASI_Mm01_00031112 predicted 2322
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014429
MORC1 MISSION shRNA Bacterial Glycerol Stock
MORC family CW-type zinc finger 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014429.3-519s21c1
Sequence:CCGGTCCAATGCCCTCATGGTTAATCTCGAGATTAACCATGAGGGCATTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014429.x-2071s1c1
Sequence:CCGGCCCAGAGAAGTCAGATTGCTACTCGAGTAGCAATCTGACTTCTCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014429.x-1766s1c1
Sequence:CCGGGCCTCAATTTATACCAGTGGACTCGAGTCCACTGGTATAAATTGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014429.3-3226s21c1
Sequence:CCGGGTATTCCCTAATCCAATTATCCTCGAGGATAATTGGATTAGGGAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014429.x-1249s1c1
Sequence:CCGGGCGTGGTTGGAATTGTTAATACTCGAGTATTAACAATTCCAACCACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014429.x-2672s1c1
Sequence:CCGGGAATACTTACATGGTCCAATACTCGAGTATTGGACCATGTAAGTATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014429.x-642s1c1
Sequence:CCGGTGTGGTACTTTGCTGGTTATTCTCGAGAATAACCAGCAAAGTACCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014429
MORC1 MISSION shRNA shRNA Plasmid DNA
MORC family CW-type zinc finger 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014429.3-519s21c1
Sequence:CCGGTCCAATGCCCTCATGGTTAATCTCGAGATTAACCATGAGGGCATTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014429.x-2071s1c1
Sequence:CCGGCCCAGAGAAGTCAGATTGCTACTCGAGTAGCAATCTGACTTCTCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014429.x-1766s1c1
Sequence:CCGGGCCTCAATTTATACCAGTGGACTCGAGTCCACTGGTATAAATTGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014429.3-3226s21c1
Sequence:CCGGGTATTCCCTAATCCAATTATCCTCGAGGATAATTGGATTAGGGAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014429.x-1249s1c1
Sequence:CCGGGCGTGGTTGGAATTGTTAATACTCGAGTATTAACAATTCCAACCACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014429.x-2672s1c1
Sequence:CCGGGAATACTTACATGGTCCAATACTCGAGTATTGGACCATGTAAGTATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014429.x-642s1c1
Sequence:CCGGTGTGGTACTTTGCTGGTTATTCTCGAGAATAACCAGCAAAGTACCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014429
MORC1 MISSION shRNA Lentiviral Transduction Particles
MORC family CW-type zinc finger 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014429.3-519s21c1
Sequence:CCGGTCCAATGCCCTCATGGTTAATCTCGAGATTAACCATGAGGGCATTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014429.x-2071s1c1
Sequence:CCGGCCCAGAGAAGTCAGATTGCTACTCGAGTAGCAATCTGACTTCTCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014429.x-1766s1c1
Sequence:CCGGGCCTCAATTTATACCAGTGGACTCGAGTCCACTGGTATAAATTGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014429.3-3226s21c1
Sequence:CCGGGTATTCCCTAATCCAATTATCCTCGAGGATAATTGGATTAGGGAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014429.x-1249s1c1
Sequence:CCGGGCGTGGTTGGAATTGTTAATACTCGAGTATTAACAATTCCAACCACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014429.x-2672s1c1
Sequence:CCGGGAATACTTACATGGTCCAATACTCGAGTATTGGACCATGTAAGTATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014429.x-642s1c1
Sequence:CCGGTGTGGTACTTTGCTGGTTATTCTCGAGAATAACCAGCAAAGTACCACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010816
MORC1 MISSION shRNA Bacterial Glycerol Stock
MORC family CW-type zinc finger 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010816.1-1799s1c1
Sequence:CCGGGCCGCAGAAGTCTCAACTTATCTCGAGATAAGTTGAGACTTCTGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010816.1-2611s1c1
Sequence:CCGGGCCCAGAGAATATAAACGAAACTCGAGTTTCGTTTATATTCTCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010816.1-1039s1c1
Sequence:CCGGCGGACAGAATTGCTTTGTCTTCTCGAGAAGACAAAGCAATTCTGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010816.1-1625s1c1
Sequence:CCGGCCTATGGATTTGTGCCAGTAACTCGAGTTACTGGCACAAATCCATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010816.1-231s1c1
Sequence:CCGGGCTGTAAGACTCGATGTGTTTCTCGAGAAACACATCGAGTCTTACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010816
MORC1 MISSION shRNA shRNA Plasmid DNA
MORC family CW-type zinc finger 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010816.1-1799s1c1
Sequence:CCGGGCCGCAGAAGTCTCAACTTATCTCGAGATAAGTTGAGACTTCTGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010816.1-2611s1c1
Sequence:CCGGGCCCAGAGAATATAAACGAAACTCGAGTTTCGTTTATATTCTCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010816.1-1039s1c1
Sequence:CCGGCGGACAGAATTGCTTTGTCTTCTCGAGAAGACAAAGCAATTCTGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010816.1-1625s1c1
Sequence:CCGGCCTATGGATTTGTGCCAGTAACTCGAGTTACTGGCACAAATCCATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010816.1-231s1c1
Sequence:CCGGGCTGTAAGACTCGATGTGTTTCTCGAGAAACACATCGAGTCTTACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010816
MORC1 MISSION shRNA Lentiviral Transduction Particles
MORC family CW-type zinc finger 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010816.1-1799s1c1
Sequence:CCGGGCCGCAGAAGTCTCAACTTATCTCGAGATAAGTTGAGACTTCTGCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010816.1-2611s1c1
Sequence:CCGGGCCCAGAGAATATAAACGAAACTCGAGTTTCGTTTATATTCTCTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010816.1-1039s1c1
Sequence:CCGGCGGACAGAATTGCTTTGTCTTCTCGAGAAGACAAAGCAATTCTGTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010816.1-1625s1c1
Sequence:CCGGCCTATGGATTTGTGCCAGTAACTCGAGTTACTGGCACAAATCCATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010816.1-231s1c1
Sequence:CCGGGCTGTAAGACTCGATGTGTTTCTCGAGAAACACATCGAGTCTTACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)