EMAIL THIS PAGE TO A FRIEND

MORC2-AS1

MORC2 antisense RNA 1

63 Gene Product Result for
Synonyms: C22orf27 NCRNA00325
Species: Human MORC2-AS1(150291)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153044 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153044 Rosetta Predictions human pricing
XR_041215 Rosetta Predictions human pricing
XR_041216 Rosetta Predictions human pricing
XR_041217 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223563 predicted 1103
2 SASI_Hs01_00223564 predicted 1073
3 SASI_Hs01_00223565 predicted 1638
4 SASI_Hs01_00223566 predicted 1512
5 SASI_Hs01_00223567 predicted 921
6 SASI_Hs01_00223568 predicted 1141
7 SASI_Hs01_00223569 predicted 931
8 SASI_Hs01_00223570 predicted 961
9 SASI_Hs01_00223571 predicted 1438
10 SASI_Hs01_00223572 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525597 predicted 693
2 SASI_Hs02_00525598 predicted 716
3 SASI_Hs02_00525599 predicted 528
4 SASI_Hs02_00525600 predicted 531
5 SASI_Hs02_00525601 predicted 1112
6 SASI_Hs02_00525602 predicted 455
7 SASI_Hs02_00525603 predicted 1236
8 SASI_Hs02_00525604 predicted 517
9 SASI_Hs02_00525605 predicted 557
10 SASI_Hs02_00525606 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525607 predicted 687
2 SASI_Hs02_00525608 predicted 714
3 SASI_Hs02_00525609 predicted 537
4 SASI_Hs02_00525610 predicted 532
5 SASI_Hs02_00525611 predicted 1109
6 SASI_Hs02_00525612 predicted 458
7 SASI_Hs02_00525613 predicted 1233
8 SASI_Hs02_00525614 predicted 519
9 SASI_Hs02_00525615 predicted 559
10 SASI_Hs02_00525616 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525617 predicted 684
2 SASI_Hs02_00525618 predicted 712
3 SASI_Hs02_00525619 predicted 532
4 SASI_Hs02_00525620 predicted 535
5 SASI_Hs02_00525621 predicted 1106
6 SASI_Hs02_00525622 predicted 461
7 SASI_Hs02_00525623 predicted 1233
8 SASI_Hs02_00525624 predicted 525
9 SASI_Hs02_00525625 predicted 556
10 SASI_Hs02_00525626 predicted 523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153044
VALIDATED
MORC2-AS1 MISSION shRNA Bacterial Glycerol Stock
MORC2 antisense RNA 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130881    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153044.1-1575s1c1
Sequence:CCGGGAGGTGGTTAGACAGGATCTTCTCGAGAAGATCCTGTCTAACCACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129191    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153044.1-1493s1c1
Sequence:CCGGCTCAAGTTACTGTGGTGAGAACTCGAGTTCTCACCACAGTAACTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153044.1-1107s1c1
Sequence:CCGGCTTGCCTTTGTCTTTGACCCTCTCGAGAGGGTCAAAGACAAAGGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127573    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153044.1-1305s1c1
Sequence:CCGGCAACAGGCTGTCCAGATCAATCTCGAGATTGATCTGGACAGCCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153044.1-1101s1c1
Sequence:CCGGGCAACGCTTGCCTTTGTCTTTCTCGAGAAAGACAAAGGCAAGCGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153044.1-1075s1c1
Sequence:CCGGCCAATGGCCATTAAAGAGAAACTCGAGTTTCTCTTTAATGGCCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153044.1-1443s1c1
Sequence:CCGGGCTGCCCAAGTCAGAGATTTACTCGAGTAAATCTCTGACTTGGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153044.1-754s1c1
Sequence:CCGGCTCTCAGTGTACTACTCCAAACTCGAGTTTGGAGTAGTACACTGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153044.1-969s1c1
Sequence:CCGGGAACCACAGGTTAGTGGTACACTCGAGTGTACCACTAACCTGTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153044
VALIDATED
MORC2-AS1 MISSION shRNA shRNA Plasmid DNA
MORC2 antisense RNA 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130881    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153044.1-1575s1c1
Sequence:CCGGGAGGTGGTTAGACAGGATCTTCTCGAGAAGATCCTGTCTAACCACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129191    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153044.1-1493s1c1
Sequence:CCGGCTCAAGTTACTGTGGTGAGAACTCGAGTTCTCACCACAGTAACTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153044.1-1107s1c1
Sequence:CCGGCTTGCCTTTGTCTTTGACCCTCTCGAGAGGGTCAAAGACAAAGGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127573    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153044.1-1305s1c1
Sequence:CCGGCAACAGGCTGTCCAGATCAATCTCGAGATTGATCTGGACAGCCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153044.1-1101s1c1
Sequence:CCGGGCAACGCTTGCCTTTGTCTTTCTCGAGAAAGACAAAGGCAAGCGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153044.1-1075s1c1
Sequence:CCGGCCAATGGCCATTAAAGAGAAACTCGAGTTTCTCTTTAATGGCCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153044.1-1443s1c1
Sequence:CCGGGCTGCCCAAGTCAGAGATTTACTCGAGTAAATCTCTGACTTGGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153044.1-754s1c1
Sequence:CCGGCTCTCAGTGTACTACTCCAAACTCGAGTTTGGAGTAGTACACTGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153044.1-969s1c1
Sequence:CCGGGAACCACAGGTTAGTGGTACACTCGAGTGTACCACTAACCTGTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153044
VALIDATED
MORC2-AS1 MISSION shRNA Lentiviral Transduction Particles
MORC2 antisense RNA 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130881    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153044.1-1575s1c1
Sequence:CCGGGAGGTGGTTAGACAGGATCTTCTCGAGAAGATCCTGTCTAACCACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129191    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153044.1-1493s1c1
Sequence:CCGGCTCAAGTTACTGTGGTGAGAACTCGAGTTCTCACCACAGTAACTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153044.1-1107s1c1
Sequence:CCGGCTTGCCTTTGTCTTTGACCCTCTCGAGAGGGTCAAAGACAAAGGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127573    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153044.1-1305s1c1
Sequence:CCGGCAACAGGCTGTCCAGATCAATCTCGAGATTGATCTGGACAGCCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153044.1-1101s1c1
Sequence:CCGGGCAACGCTTGCCTTTGTCTTTCTCGAGAAAGACAAAGGCAAGCGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153044.1-1075s1c1
Sequence:CCGGCCAATGGCCATTAAAGAGAAACTCGAGTTTCTCTTTAATGGCCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153044.1-1443s1c1
Sequence:CCGGGCTGCCCAAGTCAGAGATTTACTCGAGTAAATCTCTGACTTGGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153044.1-754s1c1
Sequence:CCGGCTCTCAGTGTACTACTCCAAACTCGAGTTTGGAGTAGTACACTGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153044.1-969s1c1
Sequence:CCGGGAACCACAGGTTAGTGGTACACTCGAGTGTACCACTAACCTGTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)