EMAIL THIS PAGE TO A FRIEND

MORC3

MORC family CW-type zinc finger 3

159 Gene Product Result for
Synonyms: NXP2 ZCW5 ZCWCC3
UniProtKB ID: Q14149, A8KA92, Q9UEZ2
Gene ID:
Human(23515) Summary: This gene encodes a protein that localizes to the nuclear matrix. The protein also has RNA binding activity, and has a predicted coiled-coil domain. [provided by RefSeq, Jul 2008]
Mouse(338467) microrchidia 3
Rat(304074) MORC family CW-type zinc finger 3
domestic guinea pig(100716794) MORC family CW-type zinc finger 3
naked mole-rat(101697058) MORC family CW-type zinc finger 3
sheep(101115929) MORC family CW-type zinc finger 3
chicken(418513) MORC family CW-type zinc finger 3
dog(610219) MORC family CW-type zinc finger 3
Horse(100061343) MORC family CW-type zinc finger 3
cow(513807) MORC family CW-type zinc finger 3
domestic cat(101083360) MORC family CW-type zinc finger 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015358 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_128334 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128334 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128334 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001045529 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001045529 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001045529 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015358 Rosetta Predictions human pricing
NM_001107109 Rosetta Predictions rat pricing
NM_001045529 Rosetta Predictions mouse pricing
XM_001004605 Rosetta Predictions mouse pricing
XM_489605 Rosetta Predictions mouse pricing
XM_898033 Rosetta Predictions mouse pricing
XM_898048 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347685 predicted 1887
2 SASI_Hs01_00140761 predicted 2531
3 SASI_Hs02_00347686 predicted 1098
4 SASI_Hs01_00140762 predicted 1504
5 SASI_Hs01_00140763 predicted 389
6 SASI_Hs01_00140765 predicted 499
7 SASI_Hs01_00140766 predicted 1298
8 SASI_Hs01_00140767 predicted 1487
9 SASI_Hs01_00140769 predicted 2233
10 SASI_Hs01_00140770 predicted 2850
11 SASI_Hs01_00140764 predicted 1383
12 SASI_Hs01_00140768 predicted 2102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225586 predicted 1308
2 SASI_Rn02_00225587 predicted 2514
3 SASI_Rn02_00225588 predicted 1324
4 SASI_Rn02_00225589 predicted 1342
5 SASI_Rn02_00225590 predicted 2581
6 SASI_Rn02_00225591 predicted 707
7 SASI_Rn02_00225592 predicted 1624
8 SASI_Rn02_00225593 predicted 893
9 SASI_Rn02_00225594 predicted 1103
10 SASI_Rn02_00225595 predicted 1514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291634 predicted 2301
2 SASI_Mm02_00291635 predicted 2129
3 SASI_Mm02_00291636 predicted 203
4 SASI_Mm02_00291637 predicted 1660
5 SASI_Mm02_00291638 predicted 2214
6 SASI_Mm02_00291639 predicted 691
7 SASI_Mm02_00291640 predicted 2868
8 SASI_Mm02_00291641 predicted 1495
9 SASI_Mm02_00291642 predicted 1456
10 SASI_Mm02_00291643 predicted 1946
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277995 predicted 2401
2 SASI_Mm01_00277996 predicted 3002
3 SASI_Mm01_00277997 predicted 2225
4 SASI_Mm01_00277998 predicted 1762
5 SASI_Mm01_00277999 predicted 1559
6 SASI_Mm01_00278000 predicted 1750
7 SASI_Mm01_00278001 predicted 2314
8 SASI_Mm01_00278002 predicted 2960
9 SASI_Mm01_00278003 predicted 1584
10 SASI_Mm01_00278004 predicted 1554
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_489605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261197 predicted 2467
2 SASI_Mm01_00261198 predicted 3067
3 SASI_Mm01_00261199 predicted 2294
4 SASI_Mm01_00261200 predicted 1636
5 SASI_Mm01_00261201 predicted 1825
6 SASI_Mm01_00261202 predicted 2388
7 SASI_Mm01_00261203 predicted 3032
8 SASI_Mm01_00261204 predicted 1662
9 SASI_Mm01_00261205 predicted 1624
10 SASI_Mm01_00261206 predicted 2118
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898033 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259768 predicted 472
2 SASI_Mm01_00259769 predicted 251
3 SASI_Mm01_00259770 predicted 285
4 SASI_Mm01_00259771 predicted 519
5 SASI_Mm01_00259772 predicted 241
6 SASI_Mm01_00259773 predicted 400
7 SASI_Mm01_00259774 predicted 441
8 SASI_Mm01_00259775 predicted 261
9 SASI_Mm01_00259776 predicted 521
10 SASI_Mm01_00259777 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898048 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203963 predicted 2428
2 SASI_Mm01_00203964 predicted 3022
3 SASI_Mm01_00203965 predicted 2247
4 SASI_Mm01_00203966 predicted 1592
5 SASI_Mm01_00203967 predicted 1777
6 SASI_Mm01_00203968 predicted 2338
7 SASI_Mm01_00203969 predicted 2986
8 SASI_Mm01_00203970 predicted 1612
9 SASI_Mm01_00203971 predicted 1575
10 SASI_Mm01_00203972 predicted 2070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015358
VALIDATED
MORC3 MISSION shRNA Bacterial Glycerol Stock
MORC family CW-type zinc finger 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015358.x-4012s1c1
Sequence:CCGGGCTTAATACGTGTCGGTCATACTCGAGTATGACCGACACGTATTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015358.x-2138s1c1
Sequence:CCGGGCCAATTACAAGAACTGAGAACTCGAGTTCTCAGTTCTTGTAATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015358.x-1301s1c1
Sequence:CCGGCCTGTCTAAAGTGGCGGAAATCTCGAGATTTCCGCCACTTTAGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015358.x-2561s1c1
Sequence:CCGGGTGAGGTTGAATTGCTGGAAACTCGAGTTTCCAGCAATTCAACCTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015358.x-721s1c1
Sequence:CCGGCCCGAGGATTTAGATGAGATACTCGAGTATCTCATCTAAATCCTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015358.2-2749s21c1
Sequence:CCGGACTCCGATCTCTTCGAGTTAACTCGAGTTAACTCGAAGAGATCGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015358.2-2558s21c1
Sequence:CCGGATTGAGAGGGACCAGTATAAACTCGAGTTTATACTGGTCCCTCTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015358.2-240s21c1
Sequence:CCGGCAGTGATAAATGACCATATATCTCGAGATATATGGTCATTTATCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015358.2-819s21c1
Sequence:CCGGACTATTCCCTGAGGGCTTATTCTCGAGAATAAGCCCTCAGGGAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015358.2-4031s21c1
Sequence:CCGGGCTTAATACGTGTCGGTCATACTCGAGTATGACCGACACGTATTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015358
VALIDATED
MORC3 MISSION shRNA shRNA Plasmid DNA
MORC family CW-type zinc finger 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015358.x-4012s1c1
Sequence:CCGGGCTTAATACGTGTCGGTCATACTCGAGTATGACCGACACGTATTAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015358.x-2138s1c1
Sequence:CCGGGCCAATTACAAGAACTGAGAACTCGAGTTCTCAGTTCTTGTAATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015358.x-1301s1c1
Sequence:CCGGCCTGTCTAAAGTGGCGGAAATCTCGAGATTTCCGCCACTTTAGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015358.x-2561s1c1
Sequence:CCGGGTGAGGTTGAATTGCTGGAAACTCGAGTTTCCAGCAATTCAACCTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015358.x-721s1c1
Sequence:CCGGCCCGAGGATTTAGATGAGATACTCGAGTATCTCATCTAAATCCTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015358.2-2749s21c1
Sequence:CCGGACTCCGATCTCTTCGAGTTAACTCGAGTTAACTCGAAGAGATCGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015358.2-2558s21c1
Sequence:CCGGATTGAGAGGGACCAGTATAAACTCGAGTTTATACTGGTCCCTCTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015358.2-240s21c1
Sequence:CCGGCAGTGATAAATGACCATATATCTCGAGATATATGGTCATTTATCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015358.2-819s21c1
Sequence:CCGGACTATTCCCTGAGGGCTTATTCTCGAGAATAAGCCCTCAGGGAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015358.2-4031s21c1
Sequence:CCGGGCTTAATACGTGTCGGTCATACTCGAGTATGACCGACACGTATTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015358
VALIDATED
MORC3 MISSION shRNA Lentiviral Transduction Particles
MORC family CW-type zinc finger 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015358.x-4012s1c1
Sequence:CCGGGCTTAATACGTGTCGGTCATACTCGAGTATGACCGACACGTATTAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015358.x-2138s1c1
Sequence:CCGGGCCAATTACAAGAACTGAGAACTCGAGTTCTCAGTTCTTGTAATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015358.x-1301s1c1
Sequence:CCGGCCTGTCTAAAGTGGCGGAAATCTCGAGATTTCCGCCACTTTAGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015358.x-2561s1c1
Sequence:CCGGGTGAGGTTGAATTGCTGGAAACTCGAGTTTCCAGCAATTCAACCTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015358.x-721s1c1
Sequence:CCGGCCCGAGGATTTAGATGAGATACTCGAGTATCTCATCTAAATCCTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015358.2-2749s21c1
Sequence:CCGGACTCCGATCTCTTCGAGTTAACTCGAGTTAACTCGAAGAGATCGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015358.2-2558s21c1
Sequence:CCGGATTGAGAGGGACCAGTATAAACTCGAGTTTATACTGGTCCCTCTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015358.2-240s21c1
Sequence:CCGGCAGTGATAAATGACCATATATCTCGAGATATATGGTCATTTATCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015358.2-819s21c1
Sequence:CCGGACTATTCCCTGAGGGCTTATTCTCGAGAATAAGCCCTCAGGGAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015358.2-4031s21c1
Sequence:CCGGGCTTAATACGTGTCGGTCATACTCGAGTATGACCGACACGTATTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128334
MORC3 MISSION shRNA Bacterial Glycerol Stock
MORC family CW-type zinc finger 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128334.2-511s1c1
Sequence:CCGGCCAGTTGGATTGTACGGGAATCTCGAGATTCCCGTACAATCCAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128334.2-227s1c1
Sequence:CCGGCCTTGATGAGTGTCAAGGAATCTCGAGATTCCTTGACACTCATCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128334.2-1437s1c1
Sequence:CCGGCGCTTGTCTAAAGTGGCGAAACTCGAGTTTCGCCACTTTAGACAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128334.2-1060s1c1
Sequence:CCGGGCCTACATTGAACGTGATGTTCTCGAGAACATCACGTTCAATGTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128334.2-2111s1c1
Sequence:CCGGGCATTCATGTTGACCTTGTAACTCGAGTTACAAGGTCAACATGAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128334
MORC3 MISSION shRNA shRNA Plasmid DNA
MORC family CW-type zinc finger 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128334.2-511s1c1
Sequence:CCGGCCAGTTGGATTGTACGGGAATCTCGAGATTCCCGTACAATCCAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128334.2-227s1c1
Sequence:CCGGCCTTGATGAGTGTCAAGGAATCTCGAGATTCCTTGACACTCATCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128334.2-1437s1c1
Sequence:CCGGCGCTTGTCTAAAGTGGCGAAACTCGAGTTTCGCCACTTTAGACAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128334.2-1060s1c1
Sequence:CCGGGCCTACATTGAACGTGATGTTCTCGAGAACATCACGTTCAATGTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128334.2-2111s1c1
Sequence:CCGGGCATTCATGTTGACCTTGTAACTCGAGTTACAAGGTCAACATGAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128334
MORC3 MISSION shRNA Lentiviral Transduction Particles
MORC family CW-type zinc finger 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128334.2-511s1c1
Sequence:CCGGCCAGTTGGATTGTACGGGAATCTCGAGATTCCCGTACAATCCAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128334.2-227s1c1
Sequence:CCGGCCTTGATGAGTGTCAAGGAATCTCGAGATTCCTTGACACTCATCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128334.2-1437s1c1
Sequence:CCGGCGCTTGTCTAAAGTGGCGAAACTCGAGTTTCGCCACTTTAGACAAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128334.2-1060s1c1
Sequence:CCGGGCCTACATTGAACGTGATGTTCTCGAGAACATCACGTTCAATGTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128334.2-2111s1c1
Sequence:CCGGGCATTCATGTTGACCTTGTAACTCGAGTTACAAGGTCAACATGAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001045529
VALIDATED
MORC3 MISSION shRNA Bacterial Glycerol Stock
MORC family CW-type zinc finger 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045529.3-1555s21c1
Sequence:CCGGGATTTAGTGCATCCTACTTATCTCGAGATAAGTAGGATGCACTAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045529.3-645s21c1
Sequence:CCGGACACCGTCAGATGATTAATTTCTCGAGAAATTAATCATCTGACGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045529.2-886s21c1
Sequence:CCGGGTGATGTTTACCGACCTAAATCTCGAGATTTAGGTCGGTAAACATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045529.2-1591s21c1
Sequence:CCGGCCTTTGCAGCAAGGATTATAACTCGAGTTATAATCCTTGCTGCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045529.2-190s21c1
Sequence:CCGGCAGTGATTAGTGACCATATATCTCGAGATATATGGTCACTAATCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045529.2-2835s21c1
Sequence:CCGGAGCGAGATCAGCAGTACTTAACTCGAGTTAAGTACTGCTGATCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045529.2-3007s21c1
Sequence:CCGGGCAGCGTAATAGCGAACTTAGCTCGAGCTAAGTTCGCTATTACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001045529
VALIDATED
MORC3 MISSION shRNA shRNA Plasmid DNA
MORC family CW-type zinc finger 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045529.3-1555s21c1
Sequence:CCGGGATTTAGTGCATCCTACTTATCTCGAGATAAGTAGGATGCACTAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045529.3-645s21c1
Sequence:CCGGACACCGTCAGATGATTAATTTCTCGAGAAATTAATCATCTGACGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045529.2-886s21c1
Sequence:CCGGGTGATGTTTACCGACCTAAATCTCGAGATTTAGGTCGGTAAACATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045529.2-1591s21c1
Sequence:CCGGCCTTTGCAGCAAGGATTATAACTCGAGTTATAATCCTTGCTGCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045529.2-190s21c1
Sequence:CCGGCAGTGATTAGTGACCATATATCTCGAGATATATGGTCACTAATCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045529.2-2835s21c1
Sequence:CCGGAGCGAGATCAGCAGTACTTAACTCGAGTTAAGTACTGCTGATCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045529.2-3007s21c1
Sequence:CCGGGCAGCGTAATAGCGAACTTAGCTCGAGCTAAGTTCGCTATTACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001045529
VALIDATED
MORC3 MISSION shRNA Lentiviral Transduction Particles
MORC family CW-type zinc finger 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045529.3-1555s21c1
Sequence:CCGGGATTTAGTGCATCCTACTTATCTCGAGATAAGTAGGATGCACTAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045529.3-645s21c1
Sequence:CCGGACACCGTCAGATGATTAATTTCTCGAGAAATTAATCATCTGACGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045529.2-886s21c1
Sequence:CCGGGTGATGTTTACCGACCTAAATCTCGAGATTTAGGTCGGTAAACATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045529.2-1591s21c1
Sequence:CCGGCCTTTGCAGCAAGGATTATAACTCGAGTTATAATCCTTGCTGCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045529.2-190s21c1
Sequence:CCGGCAGTGATTAGTGACCATATATCTCGAGATATATGGTCACTAATCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045529.2-2835s21c1
Sequence:CCGGAGCGAGATCAGCAGTACTTAACTCGAGTTAAGTACTGCTGATCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045529.2-3007s21c1
Sequence:CCGGGCAGCGTAATAGCGAACTTAGCTCGAGCTAAGTTCGCTATTACGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)