EMAIL THIS PAGE TO A FRIEND

MORC4

MORC family CW-type zinc finger 4

118 Gene Product Result for
Synonyms: ZCW4 ZCWCC2 dJ75H8.2
Gene ID:
Human(79710) Summary: In human, the four current members of the microrchidia (morc) gene family share an N-terminal ATPase-like ATP-binding region and a CW four-cysteine zinc-finger motif. The protein encoded by this gene also has a nuclear matrix binding domain and a two-stranded coiled-coil motif near its C-terminus. This gene is widely expressed at low levels in normal tissues and has elevated expression in placenta and testis. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
Mouse(75746) microrchidia 4
Rat(315914) MORC family CW-type zinc finger 4
dog(481010) MORC family CW-type zinc finger 4
domestic cat(101084779) MORC family CW-type zinc finger 4
cow(539471) MORC family CW-type zinc finger 4
Horse(100060788) MORC family CW-type zinc finger 4
sheep(101116285) MORC family CW-type zinc finger 4
naked mole-rat(101697800) MORC family CW-type zinc finger 4
Domestic Rabbit(100354224) MORC family CW-type zinc finger 4
domestic guinea pig(100726378) MORC family CW-type zinc finger 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029413 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029413 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029413 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024657 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085354 Rosetta Predictions human pricing
NM_024657 Rosetta Predictions human pricing
XM_001053814 Rosetta Predictions rat pricing
XM_236536 Rosetta Predictions rat pricing
NM_029413 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317462 predicted 1171
2 SASI_Hs02_00317463 predicted 2635
3 SASI_Hs02_00317464 predicted 806
4 SASI_Hs02_00317465 predicted 1226
5 SASI_Hs02_00317466 predicted 1061
6 SASI_Hs02_00317467 predicted 775
7 SASI_Hs02_00317468 predicted 639
8 SASI_Hs02_00317469 predicted 968
9 SASI_Hs02_00317470 predicted 2156
10 SASI_Hs02_00317471 predicted 1363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357053 predicted 1170
2 SASI_Hs01_00225434 predicted 2640
3 SASI_Hs02_00357054 predicted 805
4 SASI_Hs02_00357055 predicted 1069
5 SASI_Hs02_00357056 predicted 768
6 SASI_Hs02_00357057 predicted 638
7 SASI_Hs02_00357058 predicted 967
8 SASI_Hs01_00225440 predicted 2148
9 SASI_Hs02_00357059 predicted 1366
10 SASI_Hs02_00357060 predicted 728
11 SASI_Hs01_00225435 predicted 1380
12 SASI_Hs01_00225436 predicted 1014
13 SASI_Hs01_00225437 predicted 480
14 SASI_Hs01_00225438 predicted 1120
15 SASI_Hs01_00225439 predicted 1000
16 SASI_Hs01_00225441 predicted 1923
17 SASI_Hs01_00225442 predicted 1060
18 SASI_Hs01_00225443 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273672 predicted 1453
2 SASI_Rn02_00273673 predicted 790
3 SASI_Rn02_00273674 predicted 863
4 SASI_Rn02_00273675 predicted 1299
5 SASI_Rn02_00273676 predicted 2483
6 SASI_Rn02_00273677 predicted 1863
7 SASI_Rn02_00273678 predicted 585
8 SASI_Rn02_00273679 predicted 1867
9 SASI_Rn02_00273680 predicted 501
10 SASI_Rn02_00273681 predicted 2417
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390139 predicted 474
2 SASI_Rn02_00390140 predicted 281
3 SASI_Rn02_00390141 predicted 545
4 SASI_Rn02_00390142 predicted 705
5 SASI_Rn02_00390143 predicted 449
6 SASI_Rn02_00390144 predicted 588
7 SASI_Rn02_00390145 predicted 501
8 SASI_Rn02_00390146 predicted 599
9 SASI_Rn02_00390147 predicted 546
10 SASI_Rn02_00390148 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032313 predicted 378
2 SASI_Mm01_00032314 predicted 1066
3 SASI_Mm01_00032315 predicted 1656
4 SASI_Mm01_00032316 predicted 615
5 SASI_Mm02_00335307 predicted 1219
6 SASI_Mm01_00032317 predicted 525
7 SASI_Mm01_00032319 predicted 1122
8 SASI_Mm01_00032320 predicted 830
9 SASI_Mm01_00032321 predicted 409
10 SASI_Mm01_00032322 predicted 2774
11 SASI_Mm01_00032318 predicted 1459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029413
VALIDATED
MORC4 MISSION shRNA Bacterial Glycerol Stock
MORC family CW-type zinc finger 4
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029413.3-835s21c1
Sequence:CCGGGACTTCGATACAGATCAATATCTCGAGATATTGATCTGTATCGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029413.1-3710s1c1
Sequence:CCGGCCGTTTCATATTCCTGATAATCTCGAGATTATCAGGAATATGAAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029413.1-2658s1c1
Sequence:CCGGCCACTGGCATTCTGAATATAACTCGAGTTATATTCAGAATGCCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029413.1-451s1c1
Sequence:CCGGCTGCTAGATAATGCTGTAGATCTCGAGATCTACAGCATTATCTAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029413.1-850s1c1
Sequence:CCGGGCCATCTTGAACTATTCGATTCTCGAGAATCGAATAGTTCAAGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029413.3-2789s21c1
Sequence:CCGGTATCAGCTTGTGAGTACTAATCTCGAGATTAGTACTCACAAGCTGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029413.3-294s21c1
Sequence:CCGGCATCGCGGAGCTGCTAGATAACTCGAGTTATCTAGCAGCTCCGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029413.3-1056s21c1
Sequence:CCGGTAAGCCTACCTCCACGAATAACTCGAGTTATTCGTGGAGGTAGGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029413.3-1139s21c1
Sequence:CCGGATCATAACAACCGCCTTATTACTCGAGTAATAAGGCGGTTGTTATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029413.1-951s1c1
Sequence:CCGGCCGGAGAAACAAAGATGGAAACTCGAGTTTCCATCTTTGTTTCTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029413.1-3708s1c1
Sequence:CCGGGCCCGTTTCATATTCCTGATACTCGAGTATCAGGAATATGAAACGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029413.1-1065s1c1
Sequence:CCGGGCCAGAAACAGAGTATTCCTTCTCGAGAAGGAATACTCTGTTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029413.1-3709s1c1
Sequence:CCGGCCCGTTTCATATTCCTGATAACTCGAGTTATCAGGAATATGAAACGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029413
VALIDATED
MORC4 MISSION shRNA shRNA Plasmid DNA
MORC family CW-type zinc finger 4
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029413.3-835s21c1
Sequence:CCGGGACTTCGATACAGATCAATATCTCGAGATATTGATCTGTATCGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029413.1-3710s1c1
Sequence:CCGGCCGTTTCATATTCCTGATAATCTCGAGATTATCAGGAATATGAAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029413.1-2658s1c1
Sequence:CCGGCCACTGGCATTCTGAATATAACTCGAGTTATATTCAGAATGCCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029413.1-451s1c1
Sequence:CCGGCTGCTAGATAATGCTGTAGATCTCGAGATCTACAGCATTATCTAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029413.1-850s1c1
Sequence:CCGGGCCATCTTGAACTATTCGATTCTCGAGAATCGAATAGTTCAAGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029413.3-2789s21c1
Sequence:CCGGTATCAGCTTGTGAGTACTAATCTCGAGATTAGTACTCACAAGCTGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029413.3-294s21c1
Sequence:CCGGCATCGCGGAGCTGCTAGATAACTCGAGTTATCTAGCAGCTCCGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029413.3-1056s21c1
Sequence:CCGGTAAGCCTACCTCCACGAATAACTCGAGTTATTCGTGGAGGTAGGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029413.3-1139s21c1
Sequence:CCGGATCATAACAACCGCCTTATTACTCGAGTAATAAGGCGGTTGTTATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029413.1-951s1c1
Sequence:CCGGCCGGAGAAACAAAGATGGAAACTCGAGTTTCCATCTTTGTTTCTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029413.1-3708s1c1
Sequence:CCGGGCCCGTTTCATATTCCTGATACTCGAGTATCAGGAATATGAAACGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029413.1-1065s1c1
Sequence:CCGGGCCAGAAACAGAGTATTCCTTCTCGAGAAGGAATACTCTGTTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029413.1-3709s1c1
Sequence:CCGGCCCGTTTCATATTCCTGATAACTCGAGTTATCAGGAATATGAAACGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029413
VALIDATED
MORC4 MISSION shRNA Lentiviral Transduction Particles
MORC family CW-type zinc finger 4
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029413.3-835s21c1
Sequence:CCGGGACTTCGATACAGATCAATATCTCGAGATATTGATCTGTATCGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029413.1-3710s1c1
Sequence:CCGGCCGTTTCATATTCCTGATAATCTCGAGATTATCAGGAATATGAAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029413.1-2658s1c1
Sequence:CCGGCCACTGGCATTCTGAATATAACTCGAGTTATATTCAGAATGCCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029413.1-451s1c1
Sequence:CCGGCTGCTAGATAATGCTGTAGATCTCGAGATCTACAGCATTATCTAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029413.1-850s1c1
Sequence:CCGGGCCATCTTGAACTATTCGATTCTCGAGAATCGAATAGTTCAAGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029413.3-2789s21c1
Sequence:CCGGTATCAGCTTGTGAGTACTAATCTCGAGATTAGTACTCACAAGCTGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029413.3-294s21c1
Sequence:CCGGCATCGCGGAGCTGCTAGATAACTCGAGTTATCTAGCAGCTCCGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029413.3-1056s21c1
Sequence:CCGGTAAGCCTACCTCCACGAATAACTCGAGTTATTCGTGGAGGTAGGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029413.3-1139s21c1
Sequence:CCGGATCATAACAACCGCCTTATTACTCGAGTAATAAGGCGGTTGTTATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029413.1-951s1c1
Sequence:CCGGCCGGAGAAACAAAGATGGAAACTCGAGTTTCCATCTTTGTTTCTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029413.1-3708s1c1
Sequence:CCGGGCCCGTTTCATATTCCTGATACTCGAGTATCAGGAATATGAAACGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029413.1-1065s1c1
Sequence:CCGGGCCAGAAACAGAGTATTCCTTCTCGAGAAGGAATACTCTGTTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029413.1-3709s1c1
Sequence:CCGGCCCGTTTCATATTCCTGATAACTCGAGTTATCAGGAATATGAAACGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024657
VALIDATED
MORC4 MISSION shRNA Bacterial Glycerol Stock
MORC family CW-type zinc finger 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024657.2-1486s1c1
Sequence:CCGGCCAAGATTGGTGGCAGAAGAACTCGAGTTCTTCTGCCACCAATCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024657.2-857s1c1
Sequence:CCGGCCCATCCAAAGTACAGGAGATCTCGAGATCTCCTGTACTTTGGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024657.2-2278s1c1
Sequence:CCGGGAGGCAAATCACATACTGGATCTCGAGATCCAGTATGTGATTTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024657.2-2724s1c1
Sequence:CCGGCGAAGATGTAACAATCTCGTTCTCGAGAACGAGATTGTTACATCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024657.2-1009s1c1
Sequence:CCGGCCACCAAAGATCCTCACTGTTCTCGAGAACAGTGAGGATCTTTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024657
VALIDATED
MORC4 MISSION shRNA shRNA Plasmid DNA
MORC family CW-type zinc finger 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024657.2-1486s1c1
Sequence:CCGGCCAAGATTGGTGGCAGAAGAACTCGAGTTCTTCTGCCACCAATCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024657.2-857s1c1
Sequence:CCGGCCCATCCAAAGTACAGGAGATCTCGAGATCTCCTGTACTTTGGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024657.2-2278s1c1
Sequence:CCGGGAGGCAAATCACATACTGGATCTCGAGATCCAGTATGTGATTTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024657.2-2724s1c1
Sequence:CCGGCGAAGATGTAACAATCTCGTTCTCGAGAACGAGATTGTTACATCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024657.2-1009s1c1
Sequence:CCGGCCACCAAAGATCCTCACTGTTCTCGAGAACAGTGAGGATCTTTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024657
VALIDATED
MORC4 MISSION shRNA Lentiviral Transduction Particles
MORC family CW-type zinc finger 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024657.2-1486s1c1
Sequence:CCGGCCAAGATTGGTGGCAGAAGAACTCGAGTTCTTCTGCCACCAATCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024657.2-857s1c1
Sequence:CCGGCCCATCCAAAGTACAGGAGATCTCGAGATCTCCTGTACTTTGGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024657.2-2278s1c1
Sequence:CCGGGAGGCAAATCACATACTGGATCTCGAGATCCAGTATGTGATTTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024657.2-2724s1c1
Sequence:CCGGCGAAGATGTAACAATCTCGTTCTCGAGAACGAGATTGTTACATCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024657.2-1009s1c1
Sequence:CCGGCCACCAAAGATCCTCACTGTTCTCGAGAACAGTGAGGATCTTTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)