EMAIL THIS PAGE TO A FRIEND

MORF4

mortality factor 4

17 Gene Product Result for
Synonyms: CSR CSRB SEN SEN1
Species: Human MORF4(10934)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006792 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006792 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006792 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006792 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107983 predicted 427
2 SASI_Hs01_00107984 predicted 419
3 SASI_Hs01_00107985 predicted 425
4 SASI_Hs01_00107986 predicted 455
5 SASI_Hs01_00107987 predicted 423
6 SASI_Hs01_00107989 predicted 461
7 SASI_Hs01_00107990 predicted 422
8 SASI_Hs01_00107991 predicted 422
9 SASI_Hs01_00107988 predicted 434
10 SASI_Hs01_00107992 predicted 426
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006792
MORF4 MISSION shRNA Bacterial Glycerol Stock
mortality factor 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006792.2-425s1c1
Sequence:CCGGGCACCCAGCTACTCAACAAATCTCGAGATTTGTTGAGTAGCTGGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006792.2-237s1c1
Sequence:CCGGGCTTGTTGATGACTGGGACTTCTCGAGAAGTCCCAGTCATCAACAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006792.2-463s1c1
Sequence:CCGGGCCGAAATTCTTGCAGATTGTCTCGAGACAATCTGCAAGAATTTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006792.2-525s1c1
Sequence:CCGGCCTGAGATTATCTGTACAAATCTCGAGATTTGTACAGATAATCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006792.2-295s1c1
Sequence:CCGGGAGAAGAATGTGGATTCCATTCTCGAGAATGGAATCCACATTCTTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006792.2-462s21c1
Sequence:CCGGTGCCGAAATTCTTGCAGATTGCTCGAGCAATCTGCAAGAATTTCGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006792.2-479s21c1
Sequence:CCGGATTGTCCCGATGCACCCATGTCTCGAGACATGGGTGCATCGGGACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006792.2-424s21c1
Sequence:CCGGGGCACCCAGCTACTCAACAAACTCGAGTTTGTTGAGTAGCTGGGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006792.2-523s21c1
Sequence:CCGGCTCCTGAGATTATCTGTACAACTCGAGTTGTACAGATAATCTCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006792
MORF4 MISSION shRNA shRNA Plasmid DNA
mortality factor 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006792.2-425s1c1
Sequence:CCGGGCACCCAGCTACTCAACAAATCTCGAGATTTGTTGAGTAGCTGGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006792.2-237s1c1
Sequence:CCGGGCTTGTTGATGACTGGGACTTCTCGAGAAGTCCCAGTCATCAACAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006792.2-463s1c1
Sequence:CCGGGCCGAAATTCTTGCAGATTGTCTCGAGACAATCTGCAAGAATTTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006792.2-525s1c1
Sequence:CCGGCCTGAGATTATCTGTACAAATCTCGAGATTTGTACAGATAATCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006792.2-295s1c1
Sequence:CCGGGAGAAGAATGTGGATTCCATTCTCGAGAATGGAATCCACATTCTTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006792.2-462s21c1
Sequence:CCGGTGCCGAAATTCTTGCAGATTGCTCGAGCAATCTGCAAGAATTTCGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006792.2-479s21c1
Sequence:CCGGATTGTCCCGATGCACCCATGTCTCGAGACATGGGTGCATCGGGACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006792.2-424s21c1
Sequence:CCGGGGCACCCAGCTACTCAACAAACTCGAGTTTGTTGAGTAGCTGGGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006792.2-523s21c1
Sequence:CCGGCTCCTGAGATTATCTGTACAACTCGAGTTGTACAGATAATCTCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006792
MORF4 MISSION shRNA Lentiviral Transduction Particles
mortality factor 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006792.2-425s1c1
Sequence:CCGGGCACCCAGCTACTCAACAAATCTCGAGATTTGTTGAGTAGCTGGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006792.2-237s1c1
Sequence:CCGGGCTTGTTGATGACTGGGACTTCTCGAGAAGTCCCAGTCATCAACAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006792.2-463s1c1
Sequence:CCGGGCCGAAATTCTTGCAGATTGTCTCGAGACAATCTGCAAGAATTTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006792.2-525s1c1
Sequence:CCGGCCTGAGATTATCTGTACAAATCTCGAGATTTGTACAGATAATCTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006792.2-295s1c1
Sequence:CCGGGAGAAGAATGTGGATTCCATTCTCGAGAATGGAATCCACATTCTTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006792.2-462s21c1
Sequence:CCGGTGCCGAAATTCTTGCAGATTGCTCGAGCAATCTGCAAGAATTTCGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006792.2-479s21c1
Sequence:CCGGATTGTCCCGATGCACCCATGTCTCGAGACATGGGTGCATCGGGACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006792.2-424s21c1
Sequence:CCGGGGCACCCAGCTACTCAACAAACTCGAGTTTGTTGAGTAGCTGGGTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006792.2-523s21c1
Sequence:CCGGCTCCTGAGATTATCTGTACAACTCGAGTTGTACAGATAATCTCAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)