EMAIL THIS PAGE TO A FRIEND

MORF4L1

mortality factor 4 like 1

131 Gene Product Result for
Synonyms: Eaf3 HsT17725 MEAF3 MORFRG15 MRG15 S863-6
Gene ID:
Mouse(21761) mortality factor 4 like 1
Rat(300891) mortality factor 4 like 1
Zebrafish(436877) mortality factor 4 like 1
cow(614390) mortality factor 4 like 1
domestic cat(101092437) mortality factor 4 like 1
dog(610223) mortality factor 4 like 1
chicken(554283) mortality factor 4 like 1
sheep(101108167) mortality factor 4 like 1
domestic guinea pig(100735226) mortality factor 4 like 1
Domestic Rabbit(100340614) mortality factor 4 like 1
naked mole-rat(101700945) mortality factor 4 like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501349 Anti-MORF4L1 (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, mouse, pig
ELISA, immunohistochemistry, western blot pricing
AV32832 Anti-MORF4L1 antibody produced in rabbit IgG fraction of antiserum zebrafish, canine, mouse, rabbit, horse, guinea pig, bovine, rat, human
immunohistochemistry, western blot pricing
SAB2101498 Anti-MORF4L1 antibody produced in rabbit affinity isolated antibody rabbit, bovine, zebrafish, canine, guinea pig, horse, mouse, human, rat
western blot pricing
SAB4500181 Anti-MORF4L1 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, western blot pricing
SAB2106780 Anti-MORF4L1 antibody produced in rabbit affinity isolated antibody mouse, rabbit, human, horse, guinea pig
western blot pricing
SAB2106781 Anti-MORF4L1 antibody produced in rabbit affinity isolated antibody human, horse, mouse, guinea pig, rabbit
western blot pricing
HPA062010 Anti-MORF4L1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB1412795 Monoclonal Anti-MORF4L1 antibody produced in mouse clone 6B6, purified immunoglobulin human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006791 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024431 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024431 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024431 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127521 MISSION® esiRNA esiRNA human MORF4L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006791 Rosetta Predictions human pricing
NM_206839 Rosetta Predictions human pricing
NM_001011999 Rosetta Predictions rat pricing
NM_001039147 Rosetta Predictions mouse pricing
NM_024431 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036576 predicted 1009
2 SASI_Hs01_00036577 predicted 1005
3 SASI_Hs01_00036578 predicted 914
4 SASI_Hs01_00036579 predicted 888
5 SASI_Hs01_00036581 predicted 235
6 SASI_Hs01_00036582 predicted 1173
7 SASI_Hs01_00036583 predicted 288
8 SASI_Hs01_00036580 predicted 1174
9 SASI_Hs01_00036584 predicted 1231
10 SASI_Hs01_00036585 predicted 1234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215697 predicted 1128
2 SASI_Hs01_00215698 predicted 1121
3 SASI_Hs01_00215699 predicted 1032
4 SASI_Hs01_00215700 predicted 1006
5 SASI_Hs01_00215702 predicted 240
6 SASI_Hs01_00215703 predicted 1291
7 SASI_Hs01_00215704 predicted 381
8 SASI_Hs01_00215705 predicted 287
9 SASI_Hs01_00215701 predicted 1297
10 SASI_Hs01_00215706 predicted 1348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099008 predicted 952
2 SASI_Rn02_00200046 predicted 720
3 SASI_Rn01_00099002 predicted 829
4 SASI_Rn01_00099003 predicted 227
5 SASI_Rn01_00099005 predicted 740
6 SASI_Rn01_00099006 predicted 717
7 SASI_Rn01_00099009 predicted 958
8 SASI_Rn01_00099011 predicted 692
9 SASI_Rn02_00200047 predicted 742
10 SASI_Rn02_00200048 predicted 905
11 SASI_Rn01_00099004 predicted 742
12 SASI_Rn01_00099007 predicted 1032
13 SASI_Rn01_00099010 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039147 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289848 predicted 1364
2 SASI_Mm01_00135150 predicted 715
3 SASI_Mm02_00289849 predicted 1196
4 SASI_Mm02_00289850 predicted 913
5 SASI_Mm02_00289851 predicted 880
6 SASI_Mm02_00289852 predicted 1311
7 SASI_Mm02_00289853 predicted 864
8 SASI_Mm02_00289854 predicted 735
9 SASI_Mm02_00289855 predicted 1366
10 SASI_Mm02_00289856 predicted 740
11 SASI_Mm01_00135151 predicted 719
12 SASI_Mm01_00135152 predicted 384
13 SASI_Mm01_00135153 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327740 predicted 1247
2 SASI_Mm01_00116092 predicted 603
3 SASI_Mm02_00327741 predicted 1081
4 SASI_Mm02_00327742 predicted 788
5 SASI_Mm02_00327743 predicted 760
6 SASI_Mm02_00327744 predicted 1197
7 SASI_Mm02_00327745 predicted 745
8 SASI_Mm02_00327746 predicted 625
9 SASI_Mm02_00327747 predicted 1250
10 SASI_Mm02_00327748 predicted 630
11 SASI_Mm01_00116093 predicted 606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006791
VALIDATED
MORF4L1 MISSION shRNA Bacterial Glycerol Stock
mortality factor 4 like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006791.2-1239s21c1
Sequence:CCGGGCTTTGAAGATGTTAGTGTATCTCGAGATACACTAACATCTTCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006791.2-361s21c1
Sequence:CCGGCGGAGAGCAGAGTACTCAAATCTCGAGATTTGAGTACTCTGCTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006791.2-915s21c1
Sequence:CCGGGCTGAAATTCTTGCAGATCATCTCGAGATGATCTGCAAGAATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006791.2-275s21c1
Sequence:CCGGGTGTGTAAAGGTTGCCATAAACTCGAGTTTATGGCAACCTTTACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006791.2-1239s1c1
Sequence:CCGGGCTTTGAAGATGTTAGTGTATCTCGAGATACACTAACATCTTCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006791.2-285s1c1
Sequence:CCGGGTTGCCATAAAGGACAAACAACTCGAGTTGTTTGTCCTTTATGGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006791.2-361s1c1
Sequence:CCGGCGGAGAGCAGAGTACTCAAATCTCGAGATTTGAGTACTCTGCTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006791.2-275s1c1
Sequence:CCGGGTGTGTAAAGGTTGCCATAAACTCGAGTTTATGGCAACCTTTACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006791.2-915s1c1
Sequence:CCGGGCTGAAATTCTTGCAGATCATCTCGAGATGATCTGCAAGAATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006791
VALIDATED
MORF4L1 MISSION shRNA shRNA Plasmid DNA
mortality factor 4 like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006791.2-1239s21c1
Sequence:CCGGGCTTTGAAGATGTTAGTGTATCTCGAGATACACTAACATCTTCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006791.2-361s21c1
Sequence:CCGGCGGAGAGCAGAGTACTCAAATCTCGAGATTTGAGTACTCTGCTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006791.2-915s21c1
Sequence:CCGGGCTGAAATTCTTGCAGATCATCTCGAGATGATCTGCAAGAATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006791.2-275s21c1
Sequence:CCGGGTGTGTAAAGGTTGCCATAAACTCGAGTTTATGGCAACCTTTACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006791.2-1239s1c1
Sequence:CCGGGCTTTGAAGATGTTAGTGTATCTCGAGATACACTAACATCTTCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006791.2-285s1c1
Sequence:CCGGGTTGCCATAAAGGACAAACAACTCGAGTTGTTTGTCCTTTATGGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006791.2-361s1c1
Sequence:CCGGCGGAGAGCAGAGTACTCAAATCTCGAGATTTGAGTACTCTGCTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006791.2-275s1c1
Sequence:CCGGGTGTGTAAAGGTTGCCATAAACTCGAGTTTATGGCAACCTTTACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006791.2-915s1c1
Sequence:CCGGGCTGAAATTCTTGCAGATCATCTCGAGATGATCTGCAAGAATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006791
VALIDATED
MORF4L1 MISSION shRNA Lentiviral Transduction Particles
mortality factor 4 like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006791.2-1239s21c1
Sequence:CCGGGCTTTGAAGATGTTAGTGTATCTCGAGATACACTAACATCTTCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006791.2-361s21c1
Sequence:CCGGCGGAGAGCAGAGTACTCAAATCTCGAGATTTGAGTACTCTGCTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006791.2-915s21c1
Sequence:CCGGGCTGAAATTCTTGCAGATCATCTCGAGATGATCTGCAAGAATTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006791.2-275s21c1
Sequence:CCGGGTGTGTAAAGGTTGCCATAAACTCGAGTTTATGGCAACCTTTACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006791.2-1239s1c1
Sequence:CCGGGCTTTGAAGATGTTAGTGTATCTCGAGATACACTAACATCTTCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006791.2-285s1c1
Sequence:CCGGGTTGCCATAAAGGACAAACAACTCGAGTTGTTTGTCCTTTATGGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006791.2-361s1c1
Sequence:CCGGCGGAGAGCAGAGTACTCAAATCTCGAGATTTGAGTACTCTGCTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006791.2-275s1c1
Sequence:CCGGGTGTGTAAAGGTTGCCATAAACTCGAGTTTATGGCAACCTTTACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006791.2-915s1c1
Sequence:CCGGGCTGAAATTCTTGCAGATCATCTCGAGATGATCTGCAAGAATTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024431
VALIDATED
MORF4L1 MISSION shRNA Bacterial Glycerol Stock
mortality factor 4 like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024431.2-797s21c1
Sequence:CCGGCGAGGAAATACAGATAATAAACTCGAGTTTATTATCTGTATTTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024431.2-1036s21c1
Sequence:CCGGCCTTGCTTTATTACTGAACTACTCGAGTAGTTCAGTAATAAAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024431.2-965s21c1
Sequence:CCGGGCGCCACATTTGCTGAGATTACTCGAGTAATCTCAGCAAATGTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024431.2-976s21c1
Sequence:CCGGGCTGAGATTATTTGTGCGAATCTCGAGATTCGCACAAATAATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024431.2-1215s21c1
Sequence:CCGGTAGTCCTTCTCTTGTACAAATCTCGAGATTTGTACAAGAGAAGGACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024431.1-159s1c1
Sequence:CCGGGCCTCTTCTCTATGAAGCAAACTCGAGTTTGCTTCATAGAGAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024431.1-882s1c1
Sequence:CCGGGCTGAGATTATTTGTGCGAATCTCGAGATTCGCACAAATAATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024431.1-871s1c1
Sequence:CCGGGCGCCACATTTGCTGAGATTACTCGAGTAATCTCAGCAAATGTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024431.1-646s1c1
Sequence:CCGGCCTGCCAAGAAGAATGTGGATCTCGAGATCCACATTCTTCTTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024431
VALIDATED
MORF4L1 MISSION shRNA shRNA Plasmid DNA
mortality factor 4 like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024431.2-797s21c1
Sequence:CCGGCGAGGAAATACAGATAATAAACTCGAGTTTATTATCTGTATTTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024431.2-1036s21c1
Sequence:CCGGCCTTGCTTTATTACTGAACTACTCGAGTAGTTCAGTAATAAAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024431.2-965s21c1
Sequence:CCGGGCGCCACATTTGCTGAGATTACTCGAGTAATCTCAGCAAATGTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024431.2-976s21c1
Sequence:CCGGGCTGAGATTATTTGTGCGAATCTCGAGATTCGCACAAATAATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024431.2-1215s21c1
Sequence:CCGGTAGTCCTTCTCTTGTACAAATCTCGAGATTTGTACAAGAGAAGGACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024431.1-159s1c1
Sequence:CCGGGCCTCTTCTCTATGAAGCAAACTCGAGTTTGCTTCATAGAGAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024431.1-882s1c1
Sequence:CCGGGCTGAGATTATTTGTGCGAATCTCGAGATTCGCACAAATAATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024431.1-871s1c1
Sequence:CCGGGCGCCACATTTGCTGAGATTACTCGAGTAATCTCAGCAAATGTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024431.1-646s1c1
Sequence:CCGGCCTGCCAAGAAGAATGTGGATCTCGAGATCCACATTCTTCTTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024431
VALIDATED
MORF4L1 MISSION shRNA Lentiviral Transduction Particles
mortality factor 4 like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024431.2-797s21c1
Sequence:CCGGCGAGGAAATACAGATAATAAACTCGAGTTTATTATCTGTATTTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024431.2-1036s21c1
Sequence:CCGGCCTTGCTTTATTACTGAACTACTCGAGTAGTTCAGTAATAAAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024431.2-965s21c1
Sequence:CCGGGCGCCACATTTGCTGAGATTACTCGAGTAATCTCAGCAAATGTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024431.2-976s21c1
Sequence:CCGGGCTGAGATTATTTGTGCGAATCTCGAGATTCGCACAAATAATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024431.2-1215s21c1
Sequence:CCGGTAGTCCTTCTCTTGTACAAATCTCGAGATTTGTACAAGAGAAGGACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024431.1-159s1c1
Sequence:CCGGGCCTCTTCTCTATGAAGCAAACTCGAGTTTGCTTCATAGAGAAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024431.1-882s1c1
Sequence:CCGGGCTGAGATTATTTGTGCGAATCTCGAGATTCGCACAAATAATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024431.1-871s1c1
Sequence:CCGGGCGCCACATTTGCTGAGATTACTCGAGTAATCTCAGCAAATGTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024431.1-646s1c1
Sequence:CCGGCCTGCCAAGAAGAATGTGGATCTCGAGATCCACATTCTTCTTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)