EMAIL THIS PAGE TO A FRIEND

MORF4L2

mortality factor 4 like 2

94 Gene Product Result for
Synonyms: MORFL2 MRGX
UniProtKB ID: Q15014, B3KP92, D3DXA5, Q567V0, Q8J026
Gene ID:
Mouse(56397) mortality factor 4 like 2
Rat(317413) mortality factor 4 like 2
dog(481001) mortality factor 4 like 2
domestic cat(101097050) mortality factor 4 like 2
cow(538442) mortality factor 4 like 2
naked mole-rat(101700452) mortality factor 4 like 2
domestic guinea pig(100723928) mortality factor 4 like 2
sheep(101119883) mortality factor 4 like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019768 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019768 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019768 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012286 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012286 Rosetta Predictions human pricing
NM_001007714 Rosetta Predictions rat pricing
NM_019768 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045613 predicted 715
2 SASI_Hs01_00045615 predicted 1049
3 SASI_Hs01_00045616 predicted 1104
4 SASI_Hs01_00045618 predicted 1056
5 SASI_Hs01_00045619 predicted 979
6 SASI_Hs02_00344027 predicted 654
7 SASI_Hs01_00045620 predicted 1270
8 SASI_Hs02_00344028 predicted 1104
9 SASI_Hs01_00045621 predicted 1171
10 SASI_Hs02_00344029 predicted 543
11 SASI_Hs01_00045612 predicted 816
12 SASI_Hs01_00045614 predicted 798
13 SASI_Hs01_00045617 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007714 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087652 predicted 1168
2 SASI_Rn01_00087653 predicted 1043
3 SASI_Rn01_00087654 predicted 1090
4 SASI_Rn01_00087655 predicted 309
5 SASI_Rn01_00087656 predicted 1201
6 SASI_Rn01_00087657 predicted 1206
7 SASI_Rn01_00087658 predicted 743
8 SASI_Rn01_00087659 predicted 724
9 SASI_Rn01_00087660 predicted 1206
10 SASI_Rn01_00087661 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180367 predicted 948
2 SASI_Mm01_00180368 predicted 1023
3 SASI_Mm01_00180370 predicted 859
4 SASI_Mm01_00180372 predicted 912
5 SASI_Mm02_00324958 predicted 1016
6 SASI_Mm01_00180365 predicted 1289
7 SASI_Mm01_00180366 predicted 1173
8 SASI_Mm01_00180369 predicted 432
9 SASI_Mm01_00180371 predicted 1326
10 SASI_Mm02_00324959 predicted 1305
11 SASI_Mm01_00180373 predicted 1207
12 SASI_Mm01_00180374 predicted 1283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019768
VALIDATED
MORF4L2 MISSION shRNA Bacterial Glycerol Stock
mortality factor 4 like 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019768.3-1287s1c1
Sequence:CCGGCCGCTCACTATTGTCTGGTATCTCGAGATACCAGACAATAGTGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019768.3-911s1c1
Sequence:CCGGCGCAGGGAAATGTTGATAATACTCGAGTATTATCAACATTTCCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019768.3-439s1c1
Sequence:CCGGCGTGGACAACAATCTGCTGAACTCGAGTTCAGCAGATTGTTGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019768.3-1092s1c1
Sequence:CCGGCCTGAGATTATTCGTGAGAATCTCGAGATTCTCACGAATAATCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019768.3-1164s1c1
Sequence:CCGGGCTGGGCTATCTGCATGATTTCTCGAGAAATCATGCAGATAGCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019768.3-911s21c1
Sequence:CCGGCGCAGGGAAATGTTGATAATACTCGAGTATTATCAACATTTCCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019768.3-1681s21c1
Sequence:CCGGTTATGGTGCTTGACGTCTGTACTCGAGTACAGACGTCAAGCACCATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019768.3-1287s21c1
Sequence:CCGGCCGCTCACTATTGTCTGGTATCTCGAGATACCAGACAATAGTGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019768.3-439s21c1
Sequence:CCGGCGTGGACAACAATCTGCTGAACTCGAGTTCAGCAGATTGTTGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019768.3-1092s21c1
Sequence:CCGGCCTGAGATTATTCGTGAGAATCTCGAGATTCTCACGAATAATCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019768
VALIDATED
MORF4L2 MISSION shRNA shRNA Plasmid DNA
mortality factor 4 like 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019768.3-1287s1c1
Sequence:CCGGCCGCTCACTATTGTCTGGTATCTCGAGATACCAGACAATAGTGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019768.3-911s1c1
Sequence:CCGGCGCAGGGAAATGTTGATAATACTCGAGTATTATCAACATTTCCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019768.3-439s1c1
Sequence:CCGGCGTGGACAACAATCTGCTGAACTCGAGTTCAGCAGATTGTTGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019768.3-1092s1c1
Sequence:CCGGCCTGAGATTATTCGTGAGAATCTCGAGATTCTCACGAATAATCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019768.3-1164s1c1
Sequence:CCGGGCTGGGCTATCTGCATGATTTCTCGAGAAATCATGCAGATAGCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019768.3-911s21c1
Sequence:CCGGCGCAGGGAAATGTTGATAATACTCGAGTATTATCAACATTTCCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019768.3-1681s21c1
Sequence:CCGGTTATGGTGCTTGACGTCTGTACTCGAGTACAGACGTCAAGCACCATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019768.3-1287s21c1
Sequence:CCGGCCGCTCACTATTGTCTGGTATCTCGAGATACCAGACAATAGTGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019768.3-439s21c1
Sequence:CCGGCGTGGACAACAATCTGCTGAACTCGAGTTCAGCAGATTGTTGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019768.3-1092s21c1
Sequence:CCGGCCTGAGATTATTCGTGAGAATCTCGAGATTCTCACGAATAATCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019768
VALIDATED
MORF4L2 MISSION shRNA Lentiviral Transduction Particles
mortality factor 4 like 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019768.3-1287s1c1
Sequence:CCGGCCGCTCACTATTGTCTGGTATCTCGAGATACCAGACAATAGTGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019768.3-911s1c1
Sequence:CCGGCGCAGGGAAATGTTGATAATACTCGAGTATTATCAACATTTCCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019768.3-439s1c1
Sequence:CCGGCGTGGACAACAATCTGCTGAACTCGAGTTCAGCAGATTGTTGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019768.3-1092s1c1
Sequence:CCGGCCTGAGATTATTCGTGAGAATCTCGAGATTCTCACGAATAATCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019768.3-1164s1c1
Sequence:CCGGGCTGGGCTATCTGCATGATTTCTCGAGAAATCATGCAGATAGCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019768.3-911s21c1
Sequence:CCGGCGCAGGGAAATGTTGATAATACTCGAGTATTATCAACATTTCCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019768.3-1681s21c1
Sequence:CCGGTTATGGTGCTTGACGTCTGTACTCGAGTACAGACGTCAAGCACCATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019768.3-1287s21c1
Sequence:CCGGCCGCTCACTATTGTCTGGTATCTCGAGATACCAGACAATAGTGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019768.3-439s21c1
Sequence:CCGGCGTGGACAACAATCTGCTGAACTCGAGTTCAGCAGATTGTTGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019768.3-1092s21c1
Sequence:CCGGCCTGAGATTATTCGTGAGAATCTCGAGATTCTCACGAATAATCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012286
VALIDATED
MORF4L2 MISSION shRNA Bacterial Glycerol Stock
mortality factor 4 like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012286.1-1644s1c1
Sequence:CCGGGCATTCTATCTTTGCTCAAATCTCGAGATTTGAGCAAAGATAGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012286.1-527s1c1
Sequence:CCGGGACCAGAAAGAACAAGCAGAACTCGAGTTCTGCTTGTTCTTTCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012286.1-1050s1c1
Sequence:CCGGCTTGCATTATTGTTGGGCTATCTCGAGATAGCCCAACAATAATGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012286.1-1060s1c1
Sequence:CCGGTGTTGGGCTATTTGCATGATTCTCGAGAATCATGCAAATAGCCCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012286.1-978s1c1
Sequence:CCGGGCACCACACCTACTGAGATTACTCGAGTAATCTCAGTAGGTGTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012286.2-929s21c1
Sequence:CCGGTCTGGAGGAGTATGCAAATTGCTCGAGCAATTTGCATACTCCTCCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012286.2-1267s21c1
Sequence:CCGGTTACTGCCAGTGATTACAAAGCTCGAGCTTTGTAATCACTGGCAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012286
VALIDATED
MORF4L2 MISSION shRNA shRNA Plasmid DNA
mortality factor 4 like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012286.1-1644s1c1
Sequence:CCGGGCATTCTATCTTTGCTCAAATCTCGAGATTTGAGCAAAGATAGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012286.1-527s1c1
Sequence:CCGGGACCAGAAAGAACAAGCAGAACTCGAGTTCTGCTTGTTCTTTCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012286.1-1050s1c1
Sequence:CCGGCTTGCATTATTGTTGGGCTATCTCGAGATAGCCCAACAATAATGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012286.1-1060s1c1
Sequence:CCGGTGTTGGGCTATTTGCATGATTCTCGAGAATCATGCAAATAGCCCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012286.1-978s1c1
Sequence:CCGGGCACCACACCTACTGAGATTACTCGAGTAATCTCAGTAGGTGTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012286.2-929s21c1
Sequence:CCGGTCTGGAGGAGTATGCAAATTGCTCGAGCAATTTGCATACTCCTCCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012286.2-1267s21c1
Sequence:CCGGTTACTGCCAGTGATTACAAAGCTCGAGCTTTGTAATCACTGGCAGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012286
VALIDATED
MORF4L2 MISSION shRNA Lentiviral Transduction Particles
mortality factor 4 like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012286.1-1644s1c1
Sequence:CCGGGCATTCTATCTTTGCTCAAATCTCGAGATTTGAGCAAAGATAGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012286.1-527s1c1
Sequence:CCGGGACCAGAAAGAACAAGCAGAACTCGAGTTCTGCTTGTTCTTTCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012286.1-1050s1c1
Sequence:CCGGCTTGCATTATTGTTGGGCTATCTCGAGATAGCCCAACAATAATGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012286.1-1060s1c1
Sequence:CCGGTGTTGGGCTATTTGCATGATTCTCGAGAATCATGCAAATAGCCCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012286.1-978s1c1
Sequence:CCGGGCACCACACCTACTGAGATTACTCGAGTAATCTCAGTAGGTGTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012286.2-929s21c1
Sequence:CCGGTCTGGAGGAGTATGCAAATTGCTCGAGCAATTTGCATACTCCTCCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012286.2-1267s21c1
Sequence:CCGGTTACTGCCAGTGATTACAAAGCTCGAGCTTTGTAATCACTGGCAGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)