EMAIL THIS PAGE TO A FRIEND

MORN1

MORN repeat containing 1

93 Gene Product Result for
UniProtKB ID: Q5T089, A6NKZ6, Q8WW30, Q9H852
Gene ID:
Mouse(76866) MORN repeat containing 1
Rat(298676) MORN repeat containing 1
Horse(100064110) MORN repeat containing 1
domestic cat(101088595) MORN repeat containing 1
dog(607425) MORN repeat containing 1
cow(617176) MORN repeat containing 1
sheep(101121533) MORN repeat containing 1
domestic guinea pig(100734109) MORN repeat containing 1
naked mole-rat(101696951) MORN repeat containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024848 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024848 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024848 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081100 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081100 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081100 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024848 Rosetta Predictions human pricing
NM_001005544 Rosetta Predictions rat pricing
NM_001081100 Rosetta Predictions mouse pricing
XM_131829 Rosetta Predictions mouse pricing
XM_902494 Rosetta Predictions mouse pricing
XM_902495 Rosetta Predictions mouse pricing
XM_902497 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162250 predicted 708
2 SASI_Hs01_00162251 predicted 260
3 SASI_Hs01_00162252 predicted 660
4 SASI_Hs01_00162253 predicted 270
5 SASI_Hs01_00162254 predicted 381
6 SASI_Hs01_00162255 predicted 890
7 SASI_Hs01_00162257 predicted 326
8 SASI_Hs01_00162258 predicted 271
9 SASI_Hs01_00162259 predicted 880
10 SASI_Hs02_00357426 predicted 419
11 SASI_Hs01_00162256 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005544 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109460 predicted 639
2 SASI_Rn01_00109461 predicted 258
3 SASI_Rn01_00109462 predicted 594
4 SASI_Rn01_00109463 predicted 1238
5 SASI_Rn01_00109464 predicted 1369
6 SASI_Rn01_00109465 predicted 461
7 SASI_Rn01_00109466 predicted 1193
8 SASI_Rn01_00109467 predicted 804
9 SASI_Rn01_00109468 predicted 1302
10 SASI_Rn02_00198401 predicted 771
11 SASI_Rn01_00109469 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081100 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295181 predicted 490
2 SASI_Mm02_00295182 predicted 278
3 SASI_Mm02_00295183 predicted 806
4 SASI_Mm02_00295184 predicted 195
5 SASI_Mm02_00295185 predicted 1381
6 SASI_Mm02_00295186 predicted 1205
7 SASI_Mm02_00295187 predicted 626
8 SASI_Mm02_00295188 predicted 804
9 SASI_Mm02_00295189 predicted 479
10 SASI_Mm02_00295190 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260973 predicted 487
2 SASI_Mm01_00260974 predicted 898
3 SASI_Mm01_00260975 predicted 289
4 SASI_Mm01_00260976 predicted 817
5 SASI_Mm01_00260977 predicted 201
6 SASI_Mm01_00260978 predicted 1383
7 SASI_Mm01_00260979 predicted 1205
8 SASI_Mm01_00260980 predicted 633
9 SASI_Mm01_00260981 predicted 816
10 SASI_Mm01_00260982 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250185 predicted 284
2 SASI_Mm01_00250186 predicted 565
3 SASI_Mm01_00250187 predicted 428
4 SASI_Mm01_00250188 predicted 417
5 SASI_Mm01_00250189 predicted 289
6 SASI_Mm01_00250190 predicted 202
7 SASI_Mm01_00250191 predicted 224
8 SASI_Mm01_00250192 predicted 342
9 SASI_Mm01_00250193 predicted 405
10 SASI_Mm01_00250194 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211288 predicted 458
2 SASI_Mm01_00211289 predicted 362
3 SASI_Mm01_00211290 predicted 748
4 SASI_Mm01_00211291 predicted 364
5 SASI_Mm01_00211292 predicted 443
6 SASI_Mm01_00211293 predicted 851
7 SASI_Mm01_00211294 predicted 677
8 SASI_Mm01_00211295 predicted 850
9 SASI_Mm01_00211296 predicted 751
10 SASI_Mm01_00211297 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245881 predicted 1449
2 SASI_Mm01_00245882 predicted 495
3 SASI_Mm01_00245883 predicted 1098
4 SASI_Mm01_00245884 predicted 896
5 SASI_Mm01_00245885 predicted 1160
6 SASI_Mm01_00245886 predicted 1171
7 SASI_Mm01_00245887 predicted 288
8 SASI_Mm01_00245888 predicted 809
9 SASI_Mm01_00245889 predicted 201
10 SASI_Mm01_00245890 predicted 624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024848
MORN1 MISSION shRNA Bacterial Glycerol Stock
MORN repeat containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024848.1-96s21c1
Sequence:CCGGCGGTTATGGTGTCTACGTATACTCGAGTATACGTAGACACCATAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024848.1-314s21c1
Sequence:CCGGACGGCGTCATGGAGTACAAAGCTCGAGCTTTGTACTCCATGACGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024848.1-462s1c1
Sequence:CCGGGCTCTTTCAGAACGGTGACAACTCGAGTTGTCACCGTTCTGAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024848.1-117s1c1
Sequence:CCGGCCCAAATTCCTTCTTTCGATACTCGAGTATCGAAAGAAGGAATTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024848.1-104s1c1
Sequence:CCGGGTGTCTACGTATACCCAAATTCTCGAGAATTTGGGTATACGTAGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024848.1-118s1c1
Sequence:CCGGCCAAATTCCTTCTTTCGATATCTCGAGATATCGAAAGAAGGAATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024848.1-111s1c1
Sequence:CCGGCGTATACCCAAATTCCTTCTTCTCGAGAAGAAGGAATTTGGGTATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024848.1-133s1c1
Sequence:CCGGCGATATGAAGGAGAATGGAAACTCGAGTTTCCATTCTCCTTCATATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024848
MORN1 MISSION shRNA shRNA Plasmid DNA
MORN repeat containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024848.1-96s21c1
Sequence:CCGGCGGTTATGGTGTCTACGTATACTCGAGTATACGTAGACACCATAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024848.1-314s21c1
Sequence:CCGGACGGCGTCATGGAGTACAAAGCTCGAGCTTTGTACTCCATGACGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024848.1-462s1c1
Sequence:CCGGGCTCTTTCAGAACGGTGACAACTCGAGTTGTCACCGTTCTGAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024848.1-117s1c1
Sequence:CCGGCCCAAATTCCTTCTTTCGATACTCGAGTATCGAAAGAAGGAATTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024848.1-104s1c1
Sequence:CCGGGTGTCTACGTATACCCAAATTCTCGAGAATTTGGGTATACGTAGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024848.1-118s1c1
Sequence:CCGGCCAAATTCCTTCTTTCGATATCTCGAGATATCGAAAGAAGGAATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024848.1-111s1c1
Sequence:CCGGCGTATACCCAAATTCCTTCTTCTCGAGAAGAAGGAATTTGGGTATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024848.1-133s1c1
Sequence:CCGGCGATATGAAGGAGAATGGAAACTCGAGTTTCCATTCTCCTTCATATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024848
MORN1 MISSION shRNA Lentiviral Transduction Particles
MORN repeat containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024848.1-96s21c1
Sequence:CCGGCGGTTATGGTGTCTACGTATACTCGAGTATACGTAGACACCATAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024848.1-314s21c1
Sequence:CCGGACGGCGTCATGGAGTACAAAGCTCGAGCTTTGTACTCCATGACGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024848.1-462s1c1
Sequence:CCGGGCTCTTTCAGAACGGTGACAACTCGAGTTGTCACCGTTCTGAAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024848.1-117s1c1
Sequence:CCGGCCCAAATTCCTTCTTTCGATACTCGAGTATCGAAAGAAGGAATTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024848.1-104s1c1
Sequence:CCGGGTGTCTACGTATACCCAAATTCTCGAGAATTTGGGTATACGTAGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024848.1-118s1c1
Sequence:CCGGCCAAATTCCTTCTTTCGATATCTCGAGATATCGAAAGAAGGAATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024848.1-111s1c1
Sequence:CCGGCGTATACCCAAATTCCTTCTTCTCGAGAAGAAGGAATTTGGGTATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024848.1-133s1c1
Sequence:CCGGCGATATGAAGGAGAATGGAAACTCGAGTTTCCATTCTCCTTCATATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081100
MORN1 MISSION shRNA Bacterial Glycerol Stock
MORN repeat containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081100.1-1474s21c1
Sequence:CCGGACTCTTGGCTGTTGGACATAACTCGAGTTATGTCCAACAGCCAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081100.1-99s21c1
Sequence:CCGGCGAAACGGCTATGGCGTATATCTCGAGATATACGCCATAGCCGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081100.1-1244s21c1
Sequence:CCGGCACTGCCCAGGAACCTCTAAACTCGAGTTTAGAGGTTCCTGGGCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081100.1-457s21c1
Sequence:CCGGGCCGTGGGCAGATGATCTTTACTCGAGTAAAGATCATCTGCCCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081100.1-207s21c1
Sequence:CCGGAGTTACTACGAAGGCGAATTTCTCGAGAAATTCGCCTTCGTAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081100
MORN1 MISSION shRNA shRNA Plasmid DNA
MORN repeat containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081100.1-1474s21c1
Sequence:CCGGACTCTTGGCTGTTGGACATAACTCGAGTTATGTCCAACAGCCAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081100.1-99s21c1
Sequence:CCGGCGAAACGGCTATGGCGTATATCTCGAGATATACGCCATAGCCGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081100.1-1244s21c1
Sequence:CCGGCACTGCCCAGGAACCTCTAAACTCGAGTTTAGAGGTTCCTGGGCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081100.1-457s21c1
Sequence:CCGGGCCGTGGGCAGATGATCTTTACTCGAGTAAAGATCATCTGCCCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081100.1-207s21c1
Sequence:CCGGAGTTACTACGAAGGCGAATTTCTCGAGAAATTCGCCTTCGTAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081100
MORN1 MISSION shRNA Lentiviral Transduction Particles
MORN repeat containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081100.1-1474s21c1
Sequence:CCGGACTCTTGGCTGTTGGACATAACTCGAGTTATGTCCAACAGCCAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081100.1-99s21c1
Sequence:CCGGCGAAACGGCTATGGCGTATATCTCGAGATATACGCCATAGCCGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081100.1-1244s21c1
Sequence:CCGGCACTGCCCAGGAACCTCTAAACTCGAGTTTAGAGGTTCCTGGGCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081100.1-457s21c1
Sequence:CCGGGCCGTGGGCAGATGATCTTTACTCGAGTAAAGATCATCTGCCCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081100.1-207s21c1
Sequence:CCGGAGTTACTACGAAGGCGAATTTCTCGAGAAATTCGCCTTCGTAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)