EMAIL THIS PAGE TO A FRIEND

MORN2

MORN repeat containing 2

72 Gene Product Result for
Synonyms: BLOCK27 MOPT
UniProtKB ID: Q502X0, Q6UL00
Gene ID:
Mouse(378462) MORN repeat containing 2
Rat(500606) MORN repeat containing 2
naked mole-rat(101707525) MORN repeat containing 2
domestic guinea pig(100720890) MORN repeat containing 2
sheep(101118002) MORN repeat containing 2
Zebrafish(751675) MORN repeat containing 2
chicken(101751661) MORN repeat containing 2
dog(475733) MORN repeat containing 2
cow(616607) MORN repeat containing 2
domestic cat(101095818) MORN repeat containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA057815 Anti-MORN2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194269 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194269 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194269 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001145450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145450 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU057471 MISSION® esiRNA esiRNA targeting mouse Morn2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_041208 Rosetta Predictions human pricing
XR_041209 Rosetta Predictions human pricing
XR_041210 Rosetta Predictions human pricing
NM_001126086 Rosetta Predictions rat pricing
NM_194269 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525527 predicted 2355
2 SASI_Hs02_00525528 predicted 505
3 SASI_Hs02_00525529 predicted 487
4 SASI_Hs02_00525530 predicted 1250
5 SASI_Hs02_00525531 predicted 344
6 SASI_Hs02_00525532 predicted 1935
7 SASI_Hs02_00525533 predicted 2444
8 SASI_Hs02_00525534 predicted 357
9 SASI_Hs02_00525535 predicted 296
10 SASI_Hs02_00525536 predicted 1554
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525537 predicted 2351
2 SASI_Hs02_00525538 predicted 504
3 SASI_Hs02_00525539 predicted 492
4 SASI_Hs02_00525540 predicted 1254
5 SASI_Hs02_00525541 predicted 342
6 SASI_Hs02_00525542 predicted 1930
7 SASI_Hs02_00525543 predicted 2442
8 SASI_Hs02_00525544 predicted 357
9 SASI_Hs02_00525545 predicted 288
10 SASI_Hs02_00525546 predicted 1551
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525547 predicted 2347
2 SASI_Hs02_00525548 predicted 508
3 SASI_Hs02_00525549 predicted 492
4 SASI_Hs02_00525550 predicted 1249
5 SASI_Hs02_00525551 predicted 339
6 SASI_Hs02_00525552 predicted 1926
7 SASI_Hs02_00525553 predicted 2445
8 SASI_Hs02_00525554 predicted 354
9 SASI_Hs02_00525555 predicted 291
10 SASI_Hs02_00525556 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252873 predicted 261
2 SASI_Rn02_00252874 predicted 358
3 SASI_Rn02_00252875 predicted 415
4 SASI_Rn02_00252876 predicted 275
5 SASI_Rn02_00252877 predicted 342
6 SASI_Rn02_00252878 predicted 343
7 SASI_Rn02_00252879 predicted 267
8 SASI_Rn02_00252880 predicted 418
9 SASI_Rn02_00252881 predicted 387
10 SASI_Rn02_00252882 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194269 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156131 predicted 391
2 SASI_Mm02_00350604 predicted 293
3 SASI_Mm01_00156135 predicted 334
4 SASI_Mm01_00156136 predicted 318
5 SASI_Mm01_00156137 predicted 313
6 SASI_Mm02_00350605 predicted 284
7 SASI_Mm01_00156138 predicted 291
8 SASI_Mm01_00156139 predicted 297
9 SASI_Mm01_00156140 predicted 387
10 SASI_Mm02_00350606 predicted 314
11 SASI_Mm01_00156132 predicted 324
12 SASI_Mm01_00156133 predicted 401
13 SASI_Mm01_00156134 predicted 392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194269
MORN2 MISSION shRNA Bacterial Glycerol Stock
MORN repeat containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194269.1-324s1c1
Sequence:CCGGGCTGTGTATGAAGGACAGTTTCTCGAGAAACTGTCCTTCATACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194269.1-503s1c1
Sequence:CCGGCCTGAAACTAAAGCTCTACATCTCGAGATGTAGAGCTTTAGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194269.1-332s1c1
Sequence:CCGGTGAAGGACAGTTTAAGGACAACTCGAGTTGTCCTTAAACTGTCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194269.1-398s1c1
Sequence:CCGGGTACACTGGAAATTTCAATGACTCGAGTCATTGAAATTTCCAGTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194269.1-464s1c1
Sequence:CCGGGCAGTGGTGTGGTAACTTCCACTCGAGTGGAAGTTACCACACCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194269
MORN2 MISSION shRNA shRNA Plasmid DNA
MORN repeat containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194269.1-324s1c1
Sequence:CCGGGCTGTGTATGAAGGACAGTTTCTCGAGAAACTGTCCTTCATACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194269.1-503s1c1
Sequence:CCGGCCTGAAACTAAAGCTCTACATCTCGAGATGTAGAGCTTTAGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194269.1-332s1c1
Sequence:CCGGTGAAGGACAGTTTAAGGACAACTCGAGTTGTCCTTAAACTGTCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194269.1-398s1c1
Sequence:CCGGGTACACTGGAAATTTCAATGACTCGAGTCATTGAAATTTCCAGTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194269.1-464s1c1
Sequence:CCGGGCAGTGGTGTGGTAACTTCCACTCGAGTGGAAGTTACCACACCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194269
MORN2 MISSION shRNA Lentiviral Transduction Particles
MORN repeat containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194269.1-324s1c1
Sequence:CCGGGCTGTGTATGAAGGACAGTTTCTCGAGAAACTGTCCTTCATACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194269.1-503s1c1
Sequence:CCGGCCTGAAACTAAAGCTCTACATCTCGAGATGTAGAGCTTTAGTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194269.1-332s1c1
Sequence:CCGGTGAAGGACAGTTTAAGGACAACTCGAGTTGTCCTTAAACTGTCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194269.1-398s1c1
Sequence:CCGGGTACACTGGAAATTTCAATGACTCGAGTCATTGAAATTTCCAGTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194269.1-464s1c1
Sequence:CCGGGCAGTGGTGTGGTAACTTCCACTCGAGTGGAAGTTACCACACCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145450
MORN2 MISSION shRNA Bacterial Glycerol Stock
MORN repeat containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145450.1-461s21c1
Sequence:GTACCGGGAATATACTGATATCCAAGGACTCGAGTCCTTGGATATCAGTATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145450.1-487s21c1
Sequence:GTACCGGATGGAGTGGTAACTTTCATTTCTCGAGAAATGAAAGTTACCACTCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145450.1-411s21c1
Sequence:GTACCGGGGGCAAAGTATACTGGAAATTCTCGAGAATTTCCAGTATACTTTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145450.1-389s21c1
Sequence:GTACCGGGGGACTTACACATTCCCAAATCTCGAGATTTGGGAATGTGTAAGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145450.1-512s21c1
Sequence:GTACCGGGCTGCTCCAGACCTGAAATTACTCGAGTAATTTCAGGTCTGGAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145450
MORN2 MISSION shRNA shRNA Plasmid DNA
MORN repeat containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145450.1-461s21c1
Sequence:GTACCGGGAATATACTGATATCCAAGGACTCGAGTCCTTGGATATCAGTATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145450.1-487s21c1
Sequence:GTACCGGATGGAGTGGTAACTTTCATTTCTCGAGAAATGAAAGTTACCACTCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145450.1-411s21c1
Sequence:GTACCGGGGGCAAAGTATACTGGAAATTCTCGAGAATTTCCAGTATACTTTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145450.1-389s21c1
Sequence:GTACCGGGGGACTTACACATTCCCAAATCTCGAGATTTGGGAATGTGTAAGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145450.1-512s21c1
Sequence:GTACCGGGCTGCTCCAGACCTGAAATTACTCGAGTAATTTCAGGTCTGGAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145450
MORN2 MISSION shRNA Lentiviral Transduction Particles
MORN repeat containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145450.1-461s21c1
Sequence:GTACCGGGAATATACTGATATCCAAGGACTCGAGTCCTTGGATATCAGTATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145450.1-487s21c1
Sequence:GTACCGGATGGAGTGGTAACTTTCATTTCTCGAGAAATGAAAGTTACCACTCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145450.1-411s21c1
Sequence:GTACCGGGGGCAAAGTATACTGGAAATTCTCGAGAATTTCCAGTATACTTTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145450.1-389s21c1
Sequence:GTACCGGGGGACTTACACATTCCCAAATCTCGAGATTTGGGAATGTGTAAGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145450.1-512s21c1
Sequence:GTACCGGGCTGCTCCAGACCTGAAATTACTCGAGTAATTTCAGGTCTGGAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)