EMAIL THIS PAGE TO A FRIEND

MORN3

MORN repeat containing 3

57 Gene Product Result for
UniProtKB ID: Q6PF18, Q86YQ9
Gene ID:
Mouse(74890) MORN repeat containing 3
Rat(687615) MORN repeat containing 3
Zebrafish(550359) MORN repeat containing 3
cow(531482) MORN repeat containing 3
domestic cat(101094213) MORN repeat containing 3
dog(486260) MORN repeat containing 3
chicken(100858736) MORN repeat containing 3
sheep(101123583) MORN repeat containing 3
domestic guinea pig(100715477) MORN repeat containing 3
naked mole-rat(101700374) MORN repeat containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029112 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029112 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029112 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_132350 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_132350 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_132350 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173855 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173855 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173855 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173855 Rosetta Predictions human pricing
XM_001079404 Rosetta Predictions rat pricing
NM_029112 Rosetta Predictions mouse pricing
XM_132350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225555 predicted 907
2 SASI_Hs01_00225556 predicted 830
3 SASI_Hs01_00225557 predicted 723
4 SASI_Hs01_00225559 predicted 471
5 SASI_Hs01_00225560 predicted 723
6 SASI_Hs01_00225561 predicted 320
7 SASI_Hs01_00225562 predicted 360
8 SASI_Hs02_00368732 predicted 405
9 SASI_Hs01_00225563 predicted 255
10 SASI_Hs01_00225564 predicted 856
11 SASI_Hs01_00225558 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364264 predicted 241
2 SASI_Rn02_00364265 predicted 645
3 SASI_Rn02_00364266 predicted 574
4 SASI_Rn02_00364267 predicted 672
5 SASI_Rn02_00364268 predicted 300
6 SASI_Rn02_00364269 predicted 211
7 SASI_Rn02_00364270 predicted 242
8 SASI_Rn02_00364271 predicted 263
9 SASI_Rn02_00364272 predicted 512
10 SASI_Rn02_00364273 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029112 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334893 predicted 692
2 SASI_Mm02_00334894 predicted 574
3 SASI_Mm02_00334895 predicted 251
4 SASI_Mm02_00334896 predicted 619
5 SASI_Mm02_00334897 predicted 581
6 SASI_Mm02_00334898 predicted 520
7 SASI_Mm02_00334899 predicted 518
8 SASI_Mm02_00334900 predicted 233
9 SASI_Mm02_00334901 predicted 558
10 SASI_Mm02_00334902 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204813 predicted 897
2 SASI_Mm01_00204814 predicted 770
3 SASI_Mm01_00204815 predicted 445
4 SASI_Mm01_00204816 predicted 358
5 SASI_Mm01_00204817 predicted 343
6 SASI_Mm01_00204818 predicted 821
7 SASI_Mm01_00204819 predicted 786
8 SASI_Mm01_00204820 predicted 542
9 SASI_Mm01_00204821 predicted 724
10 SASI_Mm01_00204822 predicted 332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029112
MORN3 MISSION shRNA Bacterial Glycerol Stock
MORN repeat containing 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000378416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029112.1-212s21c1
Sequence:CCGGAGAAGAGTGGTGCGGTCTATGCTCGAGCATAGACCGCACCACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029112.1-720s21c1
Sequence:CCGGGCTGAAGGAAGCGTTGGATAACTCGAGTTATCCAACGCTTCCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029112.1-321s21c1
Sequence:CCGGAGGCTGGTGGAAAGGCGATAACTCGAGTTATCGCCTTTCCACCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029112.1-367s21c1
Sequence:CCGGTTCGGACCCAAGGAGTATTACCTCGAGGTAATACTCCTTGGGTCCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029112
MORN3 MISSION shRNA shRNA Plasmid DNA
MORN repeat containing 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000378416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029112.1-212s21c1
Sequence:CCGGAGAAGAGTGGTGCGGTCTATGCTCGAGCATAGACCGCACCACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029112.1-720s21c1
Sequence:CCGGGCTGAAGGAAGCGTTGGATAACTCGAGTTATCCAACGCTTCCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029112.1-321s21c1
Sequence:CCGGAGGCTGGTGGAAAGGCGATAACTCGAGTTATCGCCTTTCCACCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029112.1-367s21c1
Sequence:CCGGTTCGGACCCAAGGAGTATTACCTCGAGGTAATACTCCTTGGGTCCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029112
MORN3 MISSION shRNA Lentiviral Transduction Particles
MORN repeat containing 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000378416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029112.1-212s21c1
Sequence:CCGGAGAAGAGTGGTGCGGTCTATGCTCGAGCATAGACCGCACCACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029112.1-720s21c1
Sequence:CCGGGCTGAAGGAAGCGTTGGATAACTCGAGTTATCCAACGCTTCCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029112.1-321s21c1
Sequence:CCGGAGGCTGGTGGAAAGGCGATAACTCGAGTTATCGCCTTTCCACCAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029112.1-367s21c1
Sequence:CCGGTTCGGACCCAAGGAGTATTACCTCGAGGTAATACTCCTTGGGTCCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_132350
MORN3 MISSION shRNA Bacterial Glycerol Stock
MORN repeat containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_132350.4-969s1c1
Sequence:CCGGGTCAGCCGAAGCCTCTCCGTGCTCGAGCACGGAGAGGCTTCGGCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132350.4-520s1c1
Sequence:CCGGCTGGTGGAAAGGCGATAAGAACTCGAGTTCTTATCGCCTTTCCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132350.4-878s1c1
Sequence:CCGGCCCATACCTAAGGTGGAGATTCTCGAGAATCTCCACCTTAGGTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132350.4-628s1c1
Sequence:CCGGGTACTACAACAACGGCGACATCTCGAGATGTCGCCGTTGTTGTAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132350.4-345s1c1
Sequence:CCGGGCGATCACTACGTGGGCGAATCTCGAGATTCGCCCACGTAGTGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_132350
MORN3 MISSION shRNA shRNA Plasmid DNA
MORN repeat containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_132350.4-969s1c1
Sequence:CCGGGTCAGCCGAAGCCTCTCCGTGCTCGAGCACGGAGAGGCTTCGGCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132350.4-520s1c1
Sequence:CCGGCTGGTGGAAAGGCGATAAGAACTCGAGTTCTTATCGCCTTTCCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132350.4-878s1c1
Sequence:CCGGCCCATACCTAAGGTGGAGATTCTCGAGAATCTCCACCTTAGGTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132350.4-628s1c1
Sequence:CCGGGTACTACAACAACGGCGACATCTCGAGATGTCGCCGTTGTTGTAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132350.4-345s1c1
Sequence:CCGGGCGATCACTACGTGGGCGAATCTCGAGATTCGCCCACGTAGTGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_132350
MORN3 MISSION shRNA Lentiviral Transduction Particles
MORN repeat containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_132350.4-969s1c1
Sequence:CCGGGTCAGCCGAAGCCTCTCCGTGCTCGAGCACGGAGAGGCTTCGGCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132350.4-520s1c1
Sequence:CCGGCTGGTGGAAAGGCGATAAGAACTCGAGTTCTTATCGCCTTTCCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132350.4-878s1c1
Sequence:CCGGCCCATACCTAAGGTGGAGATTCTCGAGAATCTCCACCTTAGGTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132350.4-628s1c1
Sequence:CCGGGTACTACAACAACGGCGACATCTCGAGATGTCGCCGTTGTTGTAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132350.4-345s1c1
Sequence:CCGGGCGATCACTACGTGGGCGAATCTCGAGATTCGCCCACGTAGTGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173855
MORN3 MISSION shRNA Bacterial Glycerol Stock
MORN repeat containing 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173855.2-410s1c1
Sequence:CCGGCCCAAGGAGTATTATGAGGGTCTCGAGACCCTCATAATACTCCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173855.2-372s1c1
Sequence:CCGGGTGATAAGAAATCGGGTTATGCTCGAGCATAACCCGATTTCTTATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173855.2-247s1c1
Sequence:CCGGGAAGAAGAAAGGAGCCATCTACTCGAGTAGATGGCTCCTTTCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173855.2-412s1c1
Sequence:CCGGCAAGGAGTATTATGAGGGTGACTCGAGTCACCCTCATAATACTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173855.2-239s1c1
Sequence:CCGGCAGGTCTGGAAGAAGAAAGGACTCGAGTCCTTTCTTCTTCCAGACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173855.2-212s1c1
Sequence:CCGGGACAACGTGAAACACGGGAAACTCGAGTTTCCCGTGTTTCACGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173855.2-220s1c1
Sequence:CCGGGAAACACGGGAAAGGAACACACTCGAGTGTGTTCCTTTCCCGTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173855.2-203s1c1
Sequence:CCGGGAGTGGAAGGACAACGTGAAACTCGAGTTTCACGTTGTCCTTCCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173855.2-336s1c1
Sequence:CCGGGAAAGTGCAGGAGAGTCTACTCTCGAGAGTAGACTCTCCTGCACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173855.2-360s1c1
Sequence:CCGGGCTGGTGGAAAGGTGATAAGACTCGAGTCTTATCACCTTTCCACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173855.2-176s1c1
Sequence:CCGGGCTGTGAATGGCGACTACTATCTCGAGATAGTAGTCGCCATTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173855
MORN3 MISSION shRNA shRNA Plasmid DNA
MORN repeat containing 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173855.2-410s1c1
Sequence:CCGGCCCAAGGAGTATTATGAGGGTCTCGAGACCCTCATAATACTCCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173855.2-372s1c1
Sequence:CCGGGTGATAAGAAATCGGGTTATGCTCGAGCATAACCCGATTTCTTATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173855.2-247s1c1
Sequence:CCGGGAAGAAGAAAGGAGCCATCTACTCGAGTAGATGGCTCCTTTCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173855.2-412s1c1
Sequence:CCGGCAAGGAGTATTATGAGGGTGACTCGAGTCACCCTCATAATACTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173855.2-239s1c1
Sequence:CCGGCAGGTCTGGAAGAAGAAAGGACTCGAGTCCTTTCTTCTTCCAGACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173855.2-212s1c1
Sequence:CCGGGACAACGTGAAACACGGGAAACTCGAGTTTCCCGTGTTTCACGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173855.2-220s1c1
Sequence:CCGGGAAACACGGGAAAGGAACACACTCGAGTGTGTTCCTTTCCCGTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173855.2-203s1c1
Sequence:CCGGGAGTGGAAGGACAACGTGAAACTCGAGTTTCACGTTGTCCTTCCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173855.2-336s1c1
Sequence:CCGGGAAAGTGCAGGAGAGTCTACTCTCGAGAGTAGACTCTCCTGCACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173855.2-360s1c1
Sequence:CCGGGCTGGTGGAAAGGTGATAAGACTCGAGTCTTATCACCTTTCCACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173855.2-176s1c1
Sequence:CCGGGCTGTGAATGGCGACTACTATCTCGAGATAGTAGTCGCCATTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173855
MORN3 MISSION shRNA Lentiviral Transduction Particles
MORN repeat containing 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173855.2-410s1c1
Sequence:CCGGCCCAAGGAGTATTATGAGGGTCTCGAGACCCTCATAATACTCCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173855.2-372s1c1
Sequence:CCGGGTGATAAGAAATCGGGTTATGCTCGAGCATAACCCGATTTCTTATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173855.2-247s1c1
Sequence:CCGGGAAGAAGAAAGGAGCCATCTACTCGAGTAGATGGCTCCTTTCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173855.2-412s1c1
Sequence:CCGGCAAGGAGTATTATGAGGGTGACTCGAGTCACCCTCATAATACTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173855.2-239s1c1
Sequence:CCGGCAGGTCTGGAAGAAGAAAGGACTCGAGTCCTTTCTTCTTCCAGACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173855.2-212s1c1
Sequence:CCGGGACAACGTGAAACACGGGAAACTCGAGTTTCCCGTGTTTCACGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173855.2-220s1c1
Sequence:CCGGGAAACACGGGAAAGGAACACACTCGAGTGTGTTCCTTTCCCGTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173855.2-203s1c1
Sequence:CCGGGAGTGGAAGGACAACGTGAAACTCGAGTTTCACGTTGTCCTTCCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173855.2-336s1c1
Sequence:CCGGGAAAGTGCAGGAGAGTCTACTCTCGAGAGTAGACTCTCCTGCACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173855.2-360s1c1
Sequence:CCGGGCTGGTGGAAAGGTGATAAGACTCGAGTCTTATCACCTTTCCACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173855.2-176s1c1
Sequence:CCGGGCTGTGAATGGCGACTACTATCTCGAGATAGTAGTCGCCATTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)