EMAIL THIS PAGE TO A FRIEND

MORN4

MORN repeat containing 4

67 Gene Product Result for
Synonyms: C10orf83 bA548K23.4
UniProtKB ID: Q8NDC4, Q86Y54
Gene ID:
Mouse(226123) MORN repeat containing 4
Rat(293950) MORN repeat containing 4
naked mole-rat(101699157) MORN repeat containing 4
domestic guinea pig(100721032) MORN repeat containing 4
sheep(101114990) MORN repeat containing 4
Zebrafish(550131) MORN repeat containing 4
chicken(425290) MORN repeat containing 4
domestic cat(101080408) MORN repeat containing 4
cow(614519) MORN repeat containing 4
dog(477789) MORN repeat containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV53380 Anti-C10ORF83 antibody produced in rabbit affinity isolated antibody horse, canine, rabbit, zebrafish, bovine, mouse, rat, guinea pig, human
western blot pricing
HPA052718 Anti-MORN4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2107018 Anti-MORN4 antibody produced in rabbit affinity isolated antibody mouse, horse, guinea pig, human, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198108 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198108 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198108 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178832 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178832 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178832 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080831 MISSION® esiRNA esiRNA human MORN4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098831 Rosetta Predictions human pricing
NM_178832 Rosetta Predictions human pricing
NM_001024975 Rosetta Predictions rat pricing
NM_198108 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320114 predicted 882
2 SASI_Hs02_00320115 predicted 814
3 SASI_Hs02_00320116 predicted 367
4 SASI_Hs02_00320117 predicted 401
5 SASI_Hs02_00320118 predicted 548
6 SASI_Hs02_00320119 predicted 872
7 SASI_Hs02_00320120 predicted 550
8 SASI_Hs02_00320121 predicted 340
9 SASI_Hs02_00320122 predicted 635
10 SASI_Hs02_00320123 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019192 predicted 972
2 SASI_Hs01_00019193 predicted 911
3 SASI_Hs01_00019194 predicted 461
4 SASI_Hs01_00019195 predicted 487
5 SASI_Hs01_00019196 predicted 632
6 SASI_Hs01_00019197 predicted 959
7 SASI_Hs01_00019199 predicted 639
8 SASI_Hs01_00019200 predicted 430
9 SASI_Hs02_00369880 predicted 729
10 SASI_Hs02_00369881 predicted 562
11 SASI_Hs01_00019198 predicted 576
12 SASI_Hs01_00019201 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092475 predicted 939
2 SASI_Rn02_00202846 predicted 975
3 SASI_Rn01_00092476 predicted 383
4 SASI_Rn01_00092477 predicted 495
5 SASI_Rn01_00092478 predicted 461
6 SASI_Rn01_00092480 predicted 279
7 SASI_Rn01_00092481 predicted 662
8 SASI_Rn01_00092482 predicted 960
9 SASI_Rn01_00092483 predicted 1046
10 SASI_Rn02_00202847 predicted 323
11 SASI_Rn01_00092479 predicted 1029
12 SASI_Rn01_00092484 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198108 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117203 predicted 710
2 SASI_Mm01_00117204 predicted 561
3 SASI_Mm01_00117205 predicted 310
4 SASI_Mm01_00117206 predicted 213
5 SASI_Mm01_00117207 predicted 994
6 SASI_Mm01_00117209 predicted 495
7 SASI_Mm01_00117210 predicted 509
8 SASI_Mm01_00117211 predicted 1120
9 SASI_Mm01_00117212 predicted 634
10 SASI_Mm02_00350837 predicted 369
11 SASI_Mm01_00117208 predicted 1411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198108
VALIDATED
MORN4 MISSION shRNA Bacterial Glycerol Stock
MORN repeat containing 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198108.1-1699s1c1
Sequence:CCGGGCCAAGTAAGAAACCAGTGTACTCGAGTACACTGGTTTCTTACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198108.1-919s1c1
Sequence:CCGGCGAAGGTCTGTTCGAGAACAACTCGAGTTGTTCTCGAACAGACCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198108.1-744s1c1
Sequence:CCGGTGACCTTCTCAGATGGCTCAACTCGAGTTGAGCCATCTGAGAAGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198108.1-808s1c1
Sequence:CCGGAGTCTTCATTCGATATGACAACTCGAGTTGTCATATCGAATGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198108.1-890s1c1
Sequence:CCGGCCAGATGGTTCTCATGGAATACTCGAGTATTCCATGAGAACCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198108.2-280s21c1
Sequence:CCGGAGACATGGCTTTGGTCAATTGCTCGAGCAATTGACCAAAGCCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198108.2-427s21c1
Sequence:CCGGGTCGGAGTCTTCATTCGATATCTCGAGATATCGAATGAAGACTCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198108.2-711s21c1
Sequence:CCGGGTGAACAAATGAAACGGATATCTCGAGATATCCGTTTCATTTGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198108.2-569s21c1
Sequence:CCGGTACTGCGGCGTGAGAAGTGTTCTCGAGAACACTTCTCACGCCGCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198108.2-638s21c1
Sequence:CCGGTCACTGCCTGACGGAGCTTTGCTCGAGCAAAGCTCCGTCAGGCAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198108
VALIDATED
MORN4 MISSION shRNA shRNA Plasmid DNA
MORN repeat containing 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198108.1-1699s1c1
Sequence:CCGGGCCAAGTAAGAAACCAGTGTACTCGAGTACACTGGTTTCTTACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198108.1-919s1c1
Sequence:CCGGCGAAGGTCTGTTCGAGAACAACTCGAGTTGTTCTCGAACAGACCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198108.1-744s1c1
Sequence:CCGGTGACCTTCTCAGATGGCTCAACTCGAGTTGAGCCATCTGAGAAGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198108.1-808s1c1
Sequence:CCGGAGTCTTCATTCGATATGACAACTCGAGTTGTCATATCGAATGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198108.1-890s1c1
Sequence:CCGGCCAGATGGTTCTCATGGAATACTCGAGTATTCCATGAGAACCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198108.2-280s21c1
Sequence:CCGGAGACATGGCTTTGGTCAATTGCTCGAGCAATTGACCAAAGCCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198108.2-427s21c1
Sequence:CCGGGTCGGAGTCTTCATTCGATATCTCGAGATATCGAATGAAGACTCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198108.2-711s21c1
Sequence:CCGGGTGAACAAATGAAACGGATATCTCGAGATATCCGTTTCATTTGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198108.2-569s21c1
Sequence:CCGGTACTGCGGCGTGAGAAGTGTTCTCGAGAACACTTCTCACGCCGCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198108.2-638s21c1
Sequence:CCGGTCACTGCCTGACGGAGCTTTGCTCGAGCAAAGCTCCGTCAGGCAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198108
VALIDATED
MORN4 MISSION shRNA Lentiviral Transduction Particles
MORN repeat containing 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198108.1-1699s1c1
Sequence:CCGGGCCAAGTAAGAAACCAGTGTACTCGAGTACACTGGTTTCTTACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198108.1-919s1c1
Sequence:CCGGCGAAGGTCTGTTCGAGAACAACTCGAGTTGTTCTCGAACAGACCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198108.1-744s1c1
Sequence:CCGGTGACCTTCTCAGATGGCTCAACTCGAGTTGAGCCATCTGAGAAGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198108.1-808s1c1
Sequence:CCGGAGTCTTCATTCGATATGACAACTCGAGTTGTCATATCGAATGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198108.1-890s1c1
Sequence:CCGGCCAGATGGTTCTCATGGAATACTCGAGTATTCCATGAGAACCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198108.2-280s21c1
Sequence:CCGGAGACATGGCTTTGGTCAATTGCTCGAGCAATTGACCAAAGCCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198108.2-427s21c1
Sequence:CCGGGTCGGAGTCTTCATTCGATATCTCGAGATATCGAATGAAGACTCCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198108.2-711s21c1
Sequence:CCGGGTGAACAAATGAAACGGATATCTCGAGATATCCGTTTCATTTGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198108.2-569s21c1
Sequence:CCGGTACTGCGGCGTGAGAAGTGTTCTCGAGAACACTTCTCACGCCGCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198108.2-638s21c1
Sequence:CCGGTCACTGCCTGACGGAGCTTTGCTCGAGCAAAGCTCCGTCAGGCAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178832
VALIDATED
MORN4 MISSION shRNA Bacterial Glycerol Stock
MORN repeat containing 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_178832.2-470s1c1
Sequence:CCGGCCCTGATGGTTCTCATGGAATCTCGAGATTCCATGAGAACCATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_178832.2-384s1c1
Sequence:CCGGGTCGGAGTCTTCATTCGATATCTCGAGATATCGAATGAAGACTCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_178832.2-383s1c1
Sequence:CCGGCGTCGGAGTCTTCATTCGATACTCGAGTATCGAATGAAGACTCCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178832.2-399s1c1
Sequence:CCGGCGATATGACAACATGACCTTTCTCGAGAAAGGTCATGTTGTCATATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178832.2-1719s1c1
Sequence:CCGGGCTGTCTTCTTTCATCAACTTCTCGAGAAGTTGATGAAAGAAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178832.3-314s21c1
Sequence:CCGGGAATATCGTGGCGAGTGGAAGCTCGAGCTTCCACTCGCCACGATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178832.3-357s21c1
Sequence:CCGGGTCAACTGATGTTTGCAGATGCTCGAGCATCTGCAAACATCAGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178832.3-765s21c1
Sequence:CCGGGTTGATTCGAGGTGAACAAATCTCGAGATTTGTTCACCTCGAATCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178832.3-684s21c1
Sequence:CCGGCCAAGTCAGCCAGAAATCTCACTCGAGTGAGATTTCTGGCTGACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178832.3-466s21c1
Sequence:CCGGGTTTGCCCAGGGCAAGTTTAACTCGAGTTAAACTTGCCCTGGGCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178832.3-379s21c1
Sequence:CCGGTGGCACCTACCTGGGTCATTTCTCGAGAAATGACCCAGGTAGGTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178832
VALIDATED
MORN4 MISSION shRNA shRNA Plasmid DNA
MORN repeat containing 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_178832.2-470s1c1
Sequence:CCGGCCCTGATGGTTCTCATGGAATCTCGAGATTCCATGAGAACCATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_178832.2-384s1c1
Sequence:CCGGGTCGGAGTCTTCATTCGATATCTCGAGATATCGAATGAAGACTCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_178832.2-383s1c1
Sequence:CCGGCGTCGGAGTCTTCATTCGATACTCGAGTATCGAATGAAGACTCCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178832.2-399s1c1
Sequence:CCGGCGATATGACAACATGACCTTTCTCGAGAAAGGTCATGTTGTCATATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178832.2-1719s1c1
Sequence:CCGGGCTGTCTTCTTTCATCAACTTCTCGAGAAGTTGATGAAAGAAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178832.3-314s21c1
Sequence:CCGGGAATATCGTGGCGAGTGGAAGCTCGAGCTTCCACTCGCCACGATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178832.3-357s21c1
Sequence:CCGGGTCAACTGATGTTTGCAGATGCTCGAGCATCTGCAAACATCAGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178832.3-765s21c1
Sequence:CCGGGTTGATTCGAGGTGAACAAATCTCGAGATTTGTTCACCTCGAATCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178832.3-684s21c1
Sequence:CCGGCCAAGTCAGCCAGAAATCTCACTCGAGTGAGATTTCTGGCTGACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178832.3-466s21c1
Sequence:CCGGGTTTGCCCAGGGCAAGTTTAACTCGAGTTAAACTTGCCCTGGGCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178832.3-379s21c1
Sequence:CCGGTGGCACCTACCTGGGTCATTTCTCGAGAAATGACCCAGGTAGGTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178832
VALIDATED
MORN4 MISSION shRNA Lentiviral Transduction Particles
MORN repeat containing 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_178832.2-470s1c1
Sequence:CCGGCCCTGATGGTTCTCATGGAATCTCGAGATTCCATGAGAACCATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_178832.2-384s1c1
Sequence:CCGGGTCGGAGTCTTCATTCGATATCTCGAGATATCGAATGAAGACTCCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_178832.2-383s1c1
Sequence:CCGGCGTCGGAGTCTTCATTCGATACTCGAGTATCGAATGAAGACTCCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178832.2-399s1c1
Sequence:CCGGCGATATGACAACATGACCTTTCTCGAGAAAGGTCATGTTGTCATATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178832.2-1719s1c1
Sequence:CCGGGCTGTCTTCTTTCATCAACTTCTCGAGAAGTTGATGAAAGAAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178832.3-314s21c1
Sequence:CCGGGAATATCGTGGCGAGTGGAAGCTCGAGCTTCCACTCGCCACGATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178832.3-357s21c1
Sequence:CCGGGTCAACTGATGTTTGCAGATGCTCGAGCATCTGCAAACATCAGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178832.3-765s21c1
Sequence:CCGGGTTGATTCGAGGTGAACAAATCTCGAGATTTGTTCACCTCGAATCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178832.3-684s21c1
Sequence:CCGGCCAAGTCAGCCAGAAATCTCACTCGAGTGAGATTTCTGGCTGACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178832.3-466s21c1
Sequence:CCGGGTTTGCCCAGGGCAAGTTTAACTCGAGTTAAACTTGCCCTGGGCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178832.3-379s21c1
Sequence:CCGGTGGCACCTACCTGGGTCATTTCTCGAGAAATGACCCAGGTAGGTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)