EMAIL THIS PAGE TO A FRIEND

MOS

v-mos Moloney murine sarcoma viral oncogene homolog

71 Gene Product Result for
Synonyms: MSV
UniProtKB ID: P00540, Q3KPG9, Q3KPH0
Gene ID:
Human(4342) Summary: MOS is a serine/threonine kinase that activates the MAP kinase cascade through direct phosphorylation of the MAP kinase activator MEK (MAP2K1; MIM 176872) (Prasad et al., 2008 [PubMed 18246541]
Mouse(17451) Moloney sarcoma oncogene
Rat(24559) Moloney sarcoma oncogene
Zebrafish(795517) v-mos Moloney murine sarcoma viral oncogene homolog
cow(444869) v-mos Moloney murine sarcoma viral oncogene homolog
domestic cat(101081699) v-mos Moloney murine sarcoma viral oncogene homolog
dog(486959) v-mos Moloney murine sarcoma viral oncogene homolog
chicken(428537) v-mos Moloney murine sarcoma viral oncogene homolog
fruit fly(36404) CG8767 gene product from transcript CG8767-RA
sheep(101108760) v-mos Moloney murine sarcoma viral oncogene homolog
naked mole-rat(101702660) v-mos Moloney murine sarcoma viral oncogene homolog
domestic guinea pig(100712725) v-mos Moloney murine sarcoma viral oncogene homolog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020021 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020021 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020021 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005372 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139281 MISSION® esiRNA esiRNA human MOS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005372 Rosetta Predictions human pricing
NM_020102 Rosetta Predictions rat pricing
NM_020021 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181241 predicted 495
2 SASI_Hs01_00181242 predicted 422
3 SASI_Hs02_00339477 predicted 507
4 SASI_Hs01_00181244 predicted 278
5 SASI_Hs01_00181245 predicted 766
6 SASI_Hs01_00181246 predicted 788
7 SASI_Hs01_00181247 predicted 528
8 SASI_Hs01_00181248 predicted 204
9 SASI_Hs01_00181249 predicted 324
10 SASI_Hs01_00181250 predicted 410
11 SASI_Hs01_00181243 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262511 predicted 774
2 SASI_Rn02_00262512 predicted 779
3 SASI_Rn02_00262513 predicted 675
4 SASI_Rn01_00111976 predicted 685
5 SASI_Rn02_00262514 predicted 451
6 SASI_Rn02_00262515 predicted 770
7 SASI_Rn02_00262516 predicted 941
8 SASI_Rn02_00262517 predicted 773
9 SASI_Rn02_00262518 predicted 972
10 SASI_Rn02_00262519 predicted 476
11 SASI_Rn01_00111971 predicted 2194
12 SASI_Rn01_00111972 predicted 861
13 SASI_Rn01_00111973 predicted 2158
14 SASI_Rn01_00111974 predicted 2099
15 SASI_Rn01_00111975 predicted 2171
16 SASI_Rn01_00111977 predicted 1153
17 SASI_Rn01_00111978 predicted 2183
18 SASI_Rn01_00111979 predicted 1704
19 SASI_Rn01_00111980 predicted 1657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020021 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325387 predicted 302
2 SASI_Mm01_00086752 predicted 728
3 SASI_Mm01_00086753 predicted 461
4 SASI_Mm01_00086754 predicted 906
5 SASI_Mm02_00325388 predicted 1126
6 SASI_Mm02_00325389 predicted 1115
7 SASI_Mm01_00086755 predicted 604
8 SASI_Mm01_00086756 predicted 547
9 SASI_Mm01_00086757 predicted 577
10 SASI_Mm01_00086758 predicted 686
11 SASI_Mm01_00086759 predicted 767
12 SASI_Mm01_00086760 predicted 894
13 SASI_Mm01_00086761 predicted 325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020021
MOS MISSION shRNA Bacterial Glycerol Stock
v-mos Moloney murine sarcoma viral oncogene homolog
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020021.1-979s1c1
Sequence:CCGGGAACCTCAGTACGTGCAGTATCTCGAGATACTGCACGTACTGAGGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020021.1-774s1c1
Sequence:CCGGCGTTTGTAAGATCAGTGACTTCTCGAGAAGTCACTGATCTTACAAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020021.1-368s1c1
Sequence:CCGGGCTCGGTGTATAAAGCCACTTCTCGAGAAGTGGCTTTATACACCGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020021.1-414s1c1
Sequence:CCGGGCAAGTAAACAAGTGCACCAACTCGAGTTGGTGCACTTGTTTACTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020021.2-507s21c1
Sequence:CCGGGAGGGTTTGGCTCGGTGTATACTCGAGTATACACCGAGCCAAACCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020021.2-1146s21c1
Sequence:CCGGATGCAGTGGTTGCCTACAATCCTCGAGGATTGTAGGCAACCACTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020021.2-823s21c1
Sequence:CCGGGTATTCCCTAGATGTTGTTAACTCGAGTTAACAACATCTAGGGAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020021.2-633s21c1
Sequence:CCGGGACTACGCCACGACAACATAGCTCGAGCTATGTTGTCGTGGCGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020021
MOS MISSION shRNA shRNA Plasmid DNA
v-mos Moloney murine sarcoma viral oncogene homolog
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020021.1-979s1c1
Sequence:CCGGGAACCTCAGTACGTGCAGTATCTCGAGATACTGCACGTACTGAGGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020021.1-774s1c1
Sequence:CCGGCGTTTGTAAGATCAGTGACTTCTCGAGAAGTCACTGATCTTACAAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020021.1-368s1c1
Sequence:CCGGGCTCGGTGTATAAAGCCACTTCTCGAGAAGTGGCTTTATACACCGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020021.1-414s1c1
Sequence:CCGGGCAAGTAAACAAGTGCACCAACTCGAGTTGGTGCACTTGTTTACTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020021.2-507s21c1
Sequence:CCGGGAGGGTTTGGCTCGGTGTATACTCGAGTATACACCGAGCCAAACCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020021.2-1146s21c1
Sequence:CCGGATGCAGTGGTTGCCTACAATCCTCGAGGATTGTAGGCAACCACTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020021.2-823s21c1
Sequence:CCGGGTATTCCCTAGATGTTGTTAACTCGAGTTAACAACATCTAGGGAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020021.2-633s21c1
Sequence:CCGGGACTACGCCACGACAACATAGCTCGAGCTATGTTGTCGTGGCGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020021
MOS MISSION shRNA Lentiviral Transduction Particles
v-mos Moloney murine sarcoma viral oncogene homolog
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020021.1-979s1c1
Sequence:CCGGGAACCTCAGTACGTGCAGTATCTCGAGATACTGCACGTACTGAGGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020021.1-774s1c1
Sequence:CCGGCGTTTGTAAGATCAGTGACTTCTCGAGAAGTCACTGATCTTACAAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020021.1-368s1c1
Sequence:CCGGGCTCGGTGTATAAAGCCACTTCTCGAGAAGTGGCTTTATACACCGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020021.1-414s1c1
Sequence:CCGGGCAAGTAAACAAGTGCACCAACTCGAGTTGGTGCACTTGTTTACTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020021.2-507s21c1
Sequence:CCGGGAGGGTTTGGCTCGGTGTATACTCGAGTATACACCGAGCCAAACCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020021.2-1146s21c1
Sequence:CCGGATGCAGTGGTTGCCTACAATCCTCGAGGATTGTAGGCAACCACTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020021.2-823s21c1
Sequence:CCGGGTATTCCCTAGATGTTGTTAACTCGAGTTAACAACATCTAGGGAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020021.2-633s21c1
Sequence:CCGGGACTACGCCACGACAACATAGCTCGAGCTATGTTGTCGTGGCGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005372
MOS MISSION shRNA Bacterial Glycerol Stock
v-mos Moloney murine sarcoma viral oncogene homolog
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.x-509s1c1
Sequence:CCGGGAGGACAGTTAAGTTTGGGAACTCGAGTTCCCAAACTTAACTGTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.x-275s1c1
Sequence:CCGGGCACCAAGAACCGACTAGCATCTCGAGATGCTAGTCGGTTCTTGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.x-766s1c1
Sequence:CCGGGTGACGCCTAAAGCCGACATTCTCGAGAATGTCGGCTTTAGGCGTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.x-510s1c1
Sequence:CCGGAGGACAGTTAAGTTTGGGAAACTCGAGTTTCCCAAACTTAACTGTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.x-240s1c1
Sequence:CCGGCGGTGTTCCTGTGGCCATAAACTCGAGTTTATGGCCACAGGAACACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.1-796s1c1
Sequence:CCGGGCCATCACTCTCTGGCAAATGCTCGAGCATTTGCCAGAGAGTGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.1-313s1c1
Sequence:CCGGGCTGAGCTCAACGTAGCAAGGCTCGAGCCTTGCTACGTTGAGCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.1-780s1c1
Sequence:CCGGCGACATTTATTCCTTTGCCATCTCGAGATGGCAAAGGAATAAATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.1-287s1c1
Sequence:CCGGGACTAGCATCTCGGCGGAGTTCTCGAGAACTCCGCCGAGATGCTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.1-852s1c1
Sequence:CCGGGCACATACTGTACGCGGTGGTCTCGAGACCACCGCGTACAGTATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005372
MOS MISSION shRNA shRNA Plasmid DNA
v-mos Moloney murine sarcoma viral oncogene homolog
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.x-509s1c1
Sequence:CCGGGAGGACAGTTAAGTTTGGGAACTCGAGTTCCCAAACTTAACTGTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.x-275s1c1
Sequence:CCGGGCACCAAGAACCGACTAGCATCTCGAGATGCTAGTCGGTTCTTGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.x-766s1c1
Sequence:CCGGGTGACGCCTAAAGCCGACATTCTCGAGAATGTCGGCTTTAGGCGTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.x-510s1c1
Sequence:CCGGAGGACAGTTAAGTTTGGGAAACTCGAGTTTCCCAAACTTAACTGTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.x-240s1c1
Sequence:CCGGCGGTGTTCCTGTGGCCATAAACTCGAGTTTATGGCCACAGGAACACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.1-796s1c1
Sequence:CCGGGCCATCACTCTCTGGCAAATGCTCGAGCATTTGCCAGAGAGTGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.1-313s1c1
Sequence:CCGGGCTGAGCTCAACGTAGCAAGGCTCGAGCCTTGCTACGTTGAGCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.1-780s1c1
Sequence:CCGGCGACATTTATTCCTTTGCCATCTCGAGATGGCAAAGGAATAAATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.1-287s1c1
Sequence:CCGGGACTAGCATCTCGGCGGAGTTCTCGAGAACTCCGCCGAGATGCTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.1-852s1c1
Sequence:CCGGGCACATACTGTACGCGGTGGTCTCGAGACCACCGCGTACAGTATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005372
MOS MISSION shRNA Lentiviral Transduction Particles
v-mos Moloney murine sarcoma viral oncogene homolog
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.x-509s1c1
Sequence:CCGGGAGGACAGTTAAGTTTGGGAACTCGAGTTCCCAAACTTAACTGTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.x-275s1c1
Sequence:CCGGGCACCAAGAACCGACTAGCATCTCGAGATGCTAGTCGGTTCTTGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.x-766s1c1
Sequence:CCGGGTGACGCCTAAAGCCGACATTCTCGAGAATGTCGGCTTTAGGCGTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.x-510s1c1
Sequence:CCGGAGGACAGTTAAGTTTGGGAAACTCGAGTTTCCCAAACTTAACTGTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.x-240s1c1
Sequence:CCGGCGGTGTTCCTGTGGCCATAAACTCGAGTTTATGGCCACAGGAACACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.1-796s1c1
Sequence:CCGGGCCATCACTCTCTGGCAAATGCTCGAGCATTTGCCAGAGAGTGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.1-313s1c1
Sequence:CCGGGCTGAGCTCAACGTAGCAAGGCTCGAGCCTTGCTACGTTGAGCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.1-780s1c1
Sequence:CCGGCGACATTTATTCCTTTGCCATCTCGAGATGGCAAAGGAATAAATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.1-287s1c1
Sequence:CCGGGACTAGCATCTCGGCGGAGTTCTCGAGAACTCCGCCGAGATGCTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005372.1-852s1c1
Sequence:CCGGGCACATACTGTACGCGGTGGTCTCGAGACCACCGCGTACAGTATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)