EMAIL THIS PAGE TO A FRIEND

MOSPD1

motile sperm domain containing 1

150 Gene Product Result for
Synonyms: DJ473B4
UniProtKB ID: Q9UJG1, B2RE62, D3DTG5, Q5H9C5, Q5H9C7
Gene ID:
Mouse(70380) motile sperm domain containing 1
Rat(317312) motile sperm domain containing 1
Zebrafish(406678) motile sperm domain containing 1
dog(481058) motile sperm domain containing 1
chicken(422238) motile sperm domain containing 1
cow(523578) motile sperm domain containing 1
domestic guinea pig(100722947) motile sperm domain containing 1
naked mole-rat(101718750) motile sperm domain containing 1
sheep(101107333) motile sperm domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA031158 Anti-MOSPD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB3500827 Anti-MOSPD1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019556 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019556 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019556 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027409 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027409 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027409 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038991 MISSION® esiRNA esiRNA human MOSPD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019556 Rosetta Predictions human pricing
NM_001014107 Rosetta Predictions rat pricing
XM_001052988 Rosetta Predictions rat pricing
NM_027409 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014273 predicted 305
2 SASI_Hs01_00014274 predicted 269
3 SASI_Hs01_00014275 predicted 1224
4 SASI_Hs01_00014276 predicted 649
5 SASI_Hs01_00014277 predicted 342
6 SASI_Hs02_00352758 predicted 1229
7 SASI_Hs01_00014279 predicted 320
8 SASI_Hs01_00014280 predicted 292
9 SASI_Hs01_00014281 predicted 448
10 SASI_Hs01_00014282 predicted 381
11 SASI_Hs01_00014278 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075530 predicted 816
2 SASI_Rn01_00075531 predicted 241
3 SASI_Rn01_00075532 predicted 756
4 SASI_Rn01_00075533 predicted 872
5 SASI_Rn01_00075534 predicted 639
6 SASI_Rn01_00075535 predicted 564
7 SASI_Rn01_00075536 predicted 550
8 SASI_Rn01_00075537 predicted 260
9 SASI_Rn01_00075538 predicted 769
10 SASI_Rn01_00075539 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270944 predicted 822
2 SASI_Rn02_00270945 predicted 243
3 SASI_Rn02_00270946 predicted 751
4 SASI_Rn02_00270947 predicted 874
5 SASI_Rn02_00270948 predicted 642
6 SASI_Rn02_00270949 predicted 568
7 SASI_Rn02_00270950 predicted 544
8 SASI_Rn02_00270951 predicted 264
9 SASI_Rn02_00270952 predicted 764
10 SASI_Rn02_00270953 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181545 predicted 763
2 SASI_Mm01_00181549 predicted 598
3 SASI_Mm02_00332132 predicted 769
4 SASI_Mm01_00181550 predicted 778
5 SASI_Mm01_00181551 predicted 421
6 SASI_Mm01_00181552 predicted 736
7 SASI_Mm02_00332133 predicted 605
8 SASI_Mm02_00332134 predicted 780
9 SASI_Mm02_00332135 predicted 427
10 SASI_Mm01_00181553 predicted 390
11 SASI_Mm01_00181546 predicted 297
12 SASI_Mm01_00181547 predicted 261
13 SASI_Mm01_00181548 predicted 560
14 SASI_Mm01_00181554 predicted 315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019556
VALIDATED
MOSPD1 MISSION shRNA Bacterial Glycerol Stock
motile sperm domain containing 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019556.1-1161s21c1
Sequence:CCGGGCTTCGAAGTTACAGGACTAACTCGAGTTAGTCCTGTAACTTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019556.1-269s21c1
Sequence:CCGGGCAGATGATCAGTCAACACATCTCGAGATGTGTTGACTGATCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019556.1-1666s21c1
Sequence:CCGGCCAGGTGATTTATGTGGAGATCTCGAGATCTCCACATAAATCACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019556.1-387s21c1
Sequence:CCGGGTGCAGTAAAGCCTCAGTGTTCTCGAGAACACTGAGGCTTTACTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019556.1-387s1c1
Sequence:CCGGGTGCAGTAAAGCCTCAGTGTTCTCGAGAACACTGAGGCTTTACTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019556.1-292s1c1
Sequence:CCGGGCAAGTGTTGACACTGTACAACTCGAGTTGTACAGTGTCAACACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019556.1-280s1c1
Sequence:CCGGGTCAACACATAAGCAAGTGTTCTCGAGAACACTTGCTTATGTGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019556.1-1666s1c1
Sequence:CCGGCCAGGTGATTTATGTGGAGATCTCGAGATCTCCACATAAATCACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019556.1-298s1c1
Sequence:CCGGGTTGACACTGTACAATCCCTACTCGAGTAGGGATTGTACAGTGTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019556.1-1161s1c1
Sequence:CCGGGCTTCGAAGTTACAGGACTAACTCGAGTTAGTCCTGTAACTTCGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019556.1-1228s1c1
Sequence:CCGGGCTACAAACATCAGCGTTATTCTCGAGAATAACGCTGATGTTTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019556.1-269s1c1
Sequence:CCGGGCAGATGATCAGTCAACACATCTCGAGATGTGTTGACTGATCATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130221    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019556.1-2100s1c1
Sequence:CCGGCCATAGGAAATCCTCACTGTTCTCGAGAACAGTGAGGATTTCCTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019556
VALIDATED
MOSPD1 MISSION shRNA shRNA Plasmid DNA
motile sperm domain containing 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019556.1-1161s21c1
Sequence:CCGGGCTTCGAAGTTACAGGACTAACTCGAGTTAGTCCTGTAACTTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019556.1-269s21c1
Sequence:CCGGGCAGATGATCAGTCAACACATCTCGAGATGTGTTGACTGATCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019556.1-1666s21c1
Sequence:CCGGCCAGGTGATTTATGTGGAGATCTCGAGATCTCCACATAAATCACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019556.1-387s21c1
Sequence:CCGGGTGCAGTAAAGCCTCAGTGTTCTCGAGAACACTGAGGCTTTACTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019556.1-387s1c1
Sequence:CCGGGTGCAGTAAAGCCTCAGTGTTCTCGAGAACACTGAGGCTTTACTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019556.1-292s1c1
Sequence:CCGGGCAAGTGTTGACACTGTACAACTCGAGTTGTACAGTGTCAACACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019556.1-280s1c1
Sequence:CCGGGTCAACACATAAGCAAGTGTTCTCGAGAACACTTGCTTATGTGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019556.1-1666s1c1
Sequence:CCGGCCAGGTGATTTATGTGGAGATCTCGAGATCTCCACATAAATCACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019556.1-298s1c1
Sequence:CCGGGTTGACACTGTACAATCCCTACTCGAGTAGGGATTGTACAGTGTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019556.1-1161s1c1
Sequence:CCGGGCTTCGAAGTTACAGGACTAACTCGAGTTAGTCCTGTAACTTCGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019556.1-1228s1c1
Sequence:CCGGGCTACAAACATCAGCGTTATTCTCGAGAATAACGCTGATGTTTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019556.1-269s1c1
Sequence:CCGGGCAGATGATCAGTCAACACATCTCGAGATGTGTTGACTGATCATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130221    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019556.1-2100s1c1
Sequence:CCGGCCATAGGAAATCCTCACTGTTCTCGAGAACAGTGAGGATTTCCTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019556
VALIDATED
MOSPD1 MISSION shRNA Lentiviral Transduction Particles
motile sperm domain containing 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019556.1-1161s21c1
Sequence:CCGGGCTTCGAAGTTACAGGACTAACTCGAGTTAGTCCTGTAACTTCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019556.1-269s21c1
Sequence:CCGGGCAGATGATCAGTCAACACATCTCGAGATGTGTTGACTGATCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019556.1-1666s21c1
Sequence:CCGGCCAGGTGATTTATGTGGAGATCTCGAGATCTCCACATAAATCACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019556.1-387s21c1
Sequence:CCGGGTGCAGTAAAGCCTCAGTGTTCTCGAGAACACTGAGGCTTTACTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019556.1-387s1c1
Sequence:CCGGGTGCAGTAAAGCCTCAGTGTTCTCGAGAACACTGAGGCTTTACTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019556.1-292s1c1
Sequence:CCGGGCAAGTGTTGACACTGTACAACTCGAGTTGTACAGTGTCAACACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019556.1-280s1c1
Sequence:CCGGGTCAACACATAAGCAAGTGTTCTCGAGAACACTTGCTTATGTGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019556.1-1666s1c1
Sequence:CCGGCCAGGTGATTTATGTGGAGATCTCGAGATCTCCACATAAATCACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019556.1-298s1c1
Sequence:CCGGGTTGACACTGTACAATCCCTACTCGAGTAGGGATTGTACAGTGTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019556.1-1161s1c1
Sequence:CCGGGCTTCGAAGTTACAGGACTAACTCGAGTTAGTCCTGTAACTTCGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019556.1-1228s1c1
Sequence:CCGGGCTACAAACATCAGCGTTATTCTCGAGAATAACGCTGATGTTTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019556.1-269s1c1
Sequence:CCGGGCAGATGATCAGTCAACACATCTCGAGATGTGTTGACTGATCATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130221    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019556.1-2100s1c1
Sequence:CCGGCCATAGGAAATCCTCACTGTTCTCGAGAACAGTGAGGATTTCCTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027409
VALIDATED
MOSPD1 MISSION shRNA Bacterial Glycerol Stock
motile sperm domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027409.4-729s21c1
Sequence:CCGGGCCTCTCTACCTCCACTTAAGCTCGAGCTTAAGTGGAGGTAGAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027409.4-396s21c1
Sequence:CCGGGGATATTGTGATTCGTCATAGCTCGAGCTATGACGAATCACAATATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027409.4-205s21c1
Sequence:CCGGGAAGGGAATCTTCCTGTCTTTCTCGAGAAAGACAGGAAGATTCCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027409.4-1208s21c1
Sequence:CCGGTAGACGCAAGCACCAACATTACTCGAGTAATGTTGGTGCTTGCGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027409.4-434s21c1
Sequence:CCGGACTATGGTGTGATAGACAAATCTCGAGATTTGTCTATCACACCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027409.1-769s1c1
Sequence:CCGGGCTGCTTATATCTTAGGTCTTCTCGAGAAGACCTAAGATATAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027409.1-205s1c1
Sequence:CCGGGAAGGGAATCTTCCTGTCTTTCTCGAGAAAGACAGGAAGATTCCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027409.1-633s1c1
Sequence:CCGGCGTCTCTTCAGGACCTAGTTTCTCGAGAAACTAGGTCCTGAAGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027409.1-340s1c1
Sequence:CCGGCCAAATAAGTATGTTGTCGTTCTCGAGAACGACAACATACTTATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027409.1-1521s1c1
Sequence:CCGGCCTTGATGTATTAAGGAGAAACTCGAGTTTCTCCTTAATACATCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027409
VALIDATED
MOSPD1 MISSION shRNA shRNA Plasmid DNA
motile sperm domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027409.4-729s21c1
Sequence:CCGGGCCTCTCTACCTCCACTTAAGCTCGAGCTTAAGTGGAGGTAGAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027409.4-396s21c1
Sequence:CCGGGGATATTGTGATTCGTCATAGCTCGAGCTATGACGAATCACAATATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027409.4-205s21c1
Sequence:CCGGGAAGGGAATCTTCCTGTCTTTCTCGAGAAAGACAGGAAGATTCCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027409.4-1208s21c1
Sequence:CCGGTAGACGCAAGCACCAACATTACTCGAGTAATGTTGGTGCTTGCGTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027409.4-434s21c1
Sequence:CCGGACTATGGTGTGATAGACAAATCTCGAGATTTGTCTATCACACCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027409.1-769s1c1
Sequence:CCGGGCTGCTTATATCTTAGGTCTTCTCGAGAAGACCTAAGATATAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027409.1-205s1c1
Sequence:CCGGGAAGGGAATCTTCCTGTCTTTCTCGAGAAAGACAGGAAGATTCCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027409.1-633s1c1
Sequence:CCGGCGTCTCTTCAGGACCTAGTTTCTCGAGAAACTAGGTCCTGAAGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027409.1-340s1c1
Sequence:CCGGCCAAATAAGTATGTTGTCGTTCTCGAGAACGACAACATACTTATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027409.1-1521s1c1
Sequence:CCGGCCTTGATGTATTAAGGAGAAACTCGAGTTTCTCCTTAATACATCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027409
VALIDATED
MOSPD1 MISSION shRNA Lentiviral Transduction Particles
motile sperm domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027409.4-729s21c1
Sequence:CCGGGCCTCTCTACCTCCACTTAAGCTCGAGCTTAAGTGGAGGTAGAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027409.4-396s21c1
Sequence:CCGGGGATATTGTGATTCGTCATAGCTCGAGCTATGACGAATCACAATATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027409.4-205s21c1
Sequence:CCGGGAAGGGAATCTTCCTGTCTTTCTCGAGAAAGACAGGAAGATTCCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027409.4-1208s21c1
Sequence:CCGGTAGACGCAAGCACCAACATTACTCGAGTAATGTTGGTGCTTGCGTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027409.4-434s21c1
Sequence:CCGGACTATGGTGTGATAGACAAATCTCGAGATTTGTCTATCACACCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027409.1-769s1c1
Sequence:CCGGGCTGCTTATATCTTAGGTCTTCTCGAGAAGACCTAAGATATAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027409.1-205s1c1
Sequence:CCGGGAAGGGAATCTTCCTGTCTTTCTCGAGAAAGACAGGAAGATTCCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027409.1-633s1c1
Sequence:CCGGCGTCTCTTCAGGACCTAGTTTCTCGAGAAACTAGGTCCTGAAGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027409.1-340s1c1
Sequence:CCGGCCAAATAAGTATGTTGTCGTTCTCGAGAACGACAACATACTTATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027409.1-1521s1c1
Sequence:CCGGCCTTGATGTATTAAGGAGAAACTCGAGTTTCTCCTTAATACATCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)