EMAIL THIS PAGE TO A FRIEND

MOSPD2

motile sperm domain containing 2

167 Gene Product Result for
UniProtKB ID: Q8NHP6, Q8N3H2, Q8NA83
Gene ID:
Mouse(76763) motile sperm domain containing 2
Rat(363463) motile sperm domain containing 2
sheep(101122573) motile sperm domain containing 2
naked mole-rat(101720693) motile sperm domain containing 2
Domestic Rabbit(100349861) motile sperm domain containing 2
domestic guinea pig(100714536) motile sperm domain containing 2
Zebrafish(492327) motile sperm domain containing 2
cow(508293) motile sperm domain containing 2
Horse(100055695) motile sperm domain containing 2
domestic cat(101091258) motile sperm domain containing 2
dog(491747) motile sperm domain containing 2
chicken(418627) motile sperm domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003334 Anti-MOSPD2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2103986 Anti-MOSPD2 antibody produced in rabbit affinity isolated antibody rabbit, human, horse, rat, mouse, bovine, pig, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152581 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152581 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152581 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029730 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029730 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029730 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152581 Rosetta Predictions human pricing
NM_001134588 Rosetta Predictions rat pricing
NM_029730 Rosetta Predictions mouse pricing
XM_136156 Rosetta Predictions mouse pricing
XM_891689 Rosetta Predictions mouse pricing
XM_899674 Rosetta Predictions mouse pricing
XM_899680 Rosetta Predictions mouse pricing
XM_899687 Rosetta Predictions mouse pricing
XM_899692 Rosetta Predictions mouse pricing
XM_899707 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366399 predicted 475
2 SASI_Hs01_00039805 predicted 270
3 SASI_Hs01_00039807 predicted 207
4 SASI_Hs02_00366400 predicted 1129
5 SASI_Hs01_00039808 predicted 1435
6 SASI_Hs01_00039810 predicted 783
7 SASI_Hs02_00366401 predicted 362
8 SASI_Hs01_00039811 predicted 795
9 SASI_Hs01_00039813 predicted 556
10 SASI_Hs01_00039814 predicted 576
11 SASI_Hs01_00039806 predicted 1531
12 SASI_Hs01_00039809 predicted 744
13 SASI_Hs01_00039812 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134588 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257359 predicted 293
2 SASI_Rn02_00257360 predicted 695
3 SASI_Rn02_00257361 predicted 516
4 SASI_Rn02_00257362 predicted 911
5 SASI_Rn02_00257363 predicted 465
6 SASI_Rn02_00257364 predicted 356
7 SASI_Rn02_00257365 predicted 1397
8 SASI_Rn02_00257366 predicted 316
9 SASI_Rn02_00257367 predicted 222
10 SASI_Rn02_00257368 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335815 predicted 599
2 SASI_Mm02_00335816 predicted 940
3 SASI_Mm02_00335817 predicted 1572
4 SASI_Mm02_00335818 predicted 720
5 SASI_Mm02_00335819 predicted 385
6 SASI_Mm02_00335820 predicted 359
7 SASI_Mm02_00335821 predicted 1510
8 SASI_Mm02_00335822 predicted 1421
9 SASI_Mm02_00335823 predicted 337
10 SASI_Mm02_00335824 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_136156 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250787 predicted 1369
2 SASI_Mm01_00250788 predicted 643
3 SASI_Mm01_00250789 predicted 764
4 SASI_Mm01_00250790 predicted 427
5 SASI_Mm01_00250791 predicted 365
6 SASI_Mm01_00250792 predicted 398
7 SASI_Mm01_00250793 predicted 1470
8 SASI_Mm01_00250794 predicted 389
9 SASI_Mm01_00250795 predicted 418
10 SASI_Mm01_00250796 predicted 1620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_891689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205647 predicted 650
2 SASI_Mm01_00205648 predicted 763
3 SASI_Mm01_00205649 predicted 427
4 SASI_Mm01_00205650 predicted 363
5 SASI_Mm01_00205651 predicted 404
6 SASI_Mm01_00205652 predicted 383
7 SASI_Mm01_00205653 predicted 417
8 SASI_Mm01_00205654 predicted 539
9 SASI_Mm01_00205655 predicted 611
10 SASI_Mm01_00205656 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899674 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225925 predicted 280
2 SASI_Mm01_00225926 predicted 386
3 SASI_Mm01_00225927 predicted 366
4 SASI_Mm01_00225928 predicted 404
5 SASI_Mm01_00225929 predicted 365
6 SASI_Mm01_00225930 predicted 278
7 SASI_Mm01_00225931 predicted 291
8 SASI_Mm01_00225932 predicted 389
9 SASI_Mm01_00225933 predicted 401
10 SASI_Mm01_00225934 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222816 predicted 423
2 SASI_Mm01_00222817 predicted 293
3 SASI_Mm01_00222818 predicted 288
4 SASI_Mm01_00222819 predicted 328
5 SASI_Mm01_00222820 predicted 257
6 SASI_Mm01_00222821 predicted 331
7 SASI_Mm01_00222822 predicted 461
8 SASI_Mm01_00222823 predicted 376
9 SASI_Mm01_00222824 predicted 422
10 SASI_Mm01_00222825 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231194 predicted 392
2 SASI_Mm01_00231195 predicted 428
3 SASI_Mm01_00231196 predicted 363
4 SASI_Mm01_00231197 predicted 405
5 SASI_Mm01_00231198 predicted 371
6 SASI_Mm01_00231199 predicted 328
7 SASI_Mm01_00231200 predicted 382
8 SASI_Mm01_00231201 predicted 414
9 SASI_Mm01_00231202 predicted 456
10 SASI_Mm01_00231203 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899692 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231573 predicted 394
2 SASI_Mm01_00231574 predicted 428
3 SASI_Mm01_00231575 predicted 365
4 SASI_Mm01_00231576 predicted 396
5 SASI_Mm01_00231577 predicted 369
6 SASI_Mm01_00231578 predicted 328
7 SASI_Mm01_00231579 predicted 384
8 SASI_Mm01_00231580 predicted 421
9 SASI_Mm01_00231581 predicted 378
10 SASI_Mm01_00231582 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208904 predicted 641
2 SASI_Mm01_00208905 predicted 772
3 SASI_Mm01_00208906 predicted 427
4 SASI_Mm01_00208907 predicted 371
5 SASI_Mm01_00208908 predicted 395
6 SASI_Mm01_00208909 predicted 384
7 SASI_Mm01_00208910 predicted 419
8 SASI_Mm01_00208911 predicted 537
9 SASI_Mm01_00208912 predicted 620
10 SASI_Mm01_00208913 predicted 1342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152581
VALIDATED
MOSPD2 MISSION shRNA Bacterial Glycerol Stock
motile sperm domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152581.1-1416s1c1
Sequence:CCGGGCCATACTGTTGAAAGCAGTACTCGAGTACTGCTTTCAACAGTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152581.1-347s1c1
Sequence:CCGGCCCAGATGGTTATTGGAAATTCTCGAGAATTTCCAATAACCATCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152581.1-1085s1c1
Sequence:CCGGCCAGCAGAAGAACTGTACTTTCTCGAGAAAGTACAGTTCTTCTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152581.1-2549s1c1
Sequence:CCGGCCCTCCTCATTTCTAAATGAACTCGAGTTCATTTAGAAATGAGGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180740    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152581.1-2902s1c1
Sequence:CCGGGCAGAGGCAATGACATGAGTTCTCGAGAACTCATGTCATTGCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152581.2-1413s21c1
Sequence:CCGGGCCATACTGTTGAAAGCAGTACTCGAGTACTGCTTTCAACAGTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152581.2-1236s21c1
Sequence:CCGGCGGGTGCATCAGTGGATATAGCTCGAGCTATATCCACTGATGCACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152581.2-344s21c1
Sequence:CCGGCCCAGATGGTTATTGGAAATTCTCGAGAATTTCCAATAACCATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152581.2-2546s21c1
Sequence:CCGGCCCTCCTCATTTCTAAATGAACTCGAGTTCATTTAGAAATGAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152581.2-569s21c1
Sequence:CCGGATGGACTTTGTACGCTTTATCCTCGAGGATAAAGCGTACAAAGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152581
VALIDATED
MOSPD2 MISSION shRNA shRNA Plasmid DNA
motile sperm domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152581.1-1416s1c1
Sequence:CCGGGCCATACTGTTGAAAGCAGTACTCGAGTACTGCTTTCAACAGTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152581.1-347s1c1
Sequence:CCGGCCCAGATGGTTATTGGAAATTCTCGAGAATTTCCAATAACCATCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152581.1-1085s1c1
Sequence:CCGGCCAGCAGAAGAACTGTACTTTCTCGAGAAAGTACAGTTCTTCTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152581.1-2549s1c1
Sequence:CCGGCCCTCCTCATTTCTAAATGAACTCGAGTTCATTTAGAAATGAGGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180740    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152581.1-2902s1c1
Sequence:CCGGGCAGAGGCAATGACATGAGTTCTCGAGAACTCATGTCATTGCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152581.2-1413s21c1
Sequence:CCGGGCCATACTGTTGAAAGCAGTACTCGAGTACTGCTTTCAACAGTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152581.2-1236s21c1
Sequence:CCGGCGGGTGCATCAGTGGATATAGCTCGAGCTATATCCACTGATGCACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152581.2-344s21c1
Sequence:CCGGCCCAGATGGTTATTGGAAATTCTCGAGAATTTCCAATAACCATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152581.2-2546s21c1
Sequence:CCGGCCCTCCTCATTTCTAAATGAACTCGAGTTCATTTAGAAATGAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152581.2-569s21c1
Sequence:CCGGATGGACTTTGTACGCTTTATCCTCGAGGATAAAGCGTACAAAGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152581
VALIDATED
MOSPD2 MISSION shRNA Lentiviral Transduction Particles
motile sperm domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152581.1-1416s1c1
Sequence:CCGGGCCATACTGTTGAAAGCAGTACTCGAGTACTGCTTTCAACAGTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152581.1-347s1c1
Sequence:CCGGCCCAGATGGTTATTGGAAATTCTCGAGAATTTCCAATAACCATCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152581.1-1085s1c1
Sequence:CCGGCCAGCAGAAGAACTGTACTTTCTCGAGAAAGTACAGTTCTTCTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152581.1-2549s1c1
Sequence:CCGGCCCTCCTCATTTCTAAATGAACTCGAGTTCATTTAGAAATGAGGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180740    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152581.1-2902s1c1
Sequence:CCGGGCAGAGGCAATGACATGAGTTCTCGAGAACTCATGTCATTGCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152581.2-1413s21c1
Sequence:CCGGGCCATACTGTTGAAAGCAGTACTCGAGTACTGCTTTCAACAGTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152581.2-1236s21c1
Sequence:CCGGCGGGTGCATCAGTGGATATAGCTCGAGCTATATCCACTGATGCACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152581.2-344s21c1
Sequence:CCGGCCCAGATGGTTATTGGAAATTCTCGAGAATTTCCAATAACCATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152581.2-2546s21c1
Sequence:CCGGCCCTCCTCATTTCTAAATGAACTCGAGTTCATTTAGAAATGAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152581.2-569s21c1
Sequence:CCGGATGGACTTTGTACGCTTTATCCTCGAGGATAAAGCGTACAAAGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029730
VALIDATED
MOSPD2 MISSION shRNA Bacterial Glycerol Stock
motile sperm domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029730.3-1828s21c1
Sequence:CCGGAGACGTTTGAGGCATTGATTACTCGAGTAATCAATGCCTCAAACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029730.3-1258s21c1
Sequence:CCGGTCCCGGAGCTTCCATTGATATCTCGAGATATCAATGGAAGCTCCGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029730.3-565s21c1
Sequence:CCGGGTCCGAAACTGGACTCAATAGCTCGAGCTATTGAGTCCAGTTTCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029730.3-379s21c1
Sequence:CCGGATTAGAACTTGGTGGTATTTACTCGAGTAAATACCACCAAGTTCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029730.3-593s21c1
Sequence:CCGGATGGACTTTGTACGATTTATCCTCGAGGATAAATCGTACAAAGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029730
VALIDATED
MOSPD2 MISSION shRNA shRNA Plasmid DNA
motile sperm domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029730.3-1828s21c1
Sequence:CCGGAGACGTTTGAGGCATTGATTACTCGAGTAATCAATGCCTCAAACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029730.3-1258s21c1
Sequence:CCGGTCCCGGAGCTTCCATTGATATCTCGAGATATCAATGGAAGCTCCGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029730.3-565s21c1
Sequence:CCGGGTCCGAAACTGGACTCAATAGCTCGAGCTATTGAGTCCAGTTTCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029730.3-379s21c1
Sequence:CCGGATTAGAACTTGGTGGTATTTACTCGAGTAAATACCACCAAGTTCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029730.3-593s21c1
Sequence:CCGGATGGACTTTGTACGATTTATCCTCGAGGATAAATCGTACAAAGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029730
VALIDATED
MOSPD2 MISSION shRNA Lentiviral Transduction Particles
motile sperm domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029730.3-1828s21c1
Sequence:CCGGAGACGTTTGAGGCATTGATTACTCGAGTAATCAATGCCTCAAACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029730.3-1258s21c1
Sequence:CCGGTCCCGGAGCTTCCATTGATATCTCGAGATATCAATGGAAGCTCCGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029730.3-565s21c1
Sequence:CCGGGTCCGAAACTGGACTCAATAGCTCGAGCTATTGAGTCCAGTTTCGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029730.3-379s21c1
Sequence:CCGGATTAGAACTTGGTGGTATTTACTCGAGTAAATACCACCAAGTTCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029730.3-593s21c1
Sequence:CCGGATGGACTTTGTACGATTTATCCTCGAGGATAAATCGTACAAAGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)