EMAIL THIS PAGE TO A FRIEND

MOSPD3

motile sperm domain containing 3

98 Gene Product Result for
Synonyms: CDS3 NET30
Gene ID:
Human(64598) Summary: This gene encodes a multi-pass membrane protein with a major sperm protein (MSP) domain. The deletion of a similar mouse gene is associated with defective cardiac development and neonatal lethality. Alternate transcriptional splice variants, encoding different isoforms, have been described. [provided by RefSeq, Jul 2008]
Mouse(68929) motile sperm domain containing 3
Rat(288557) motile sperm domain containing 3
cow(506163) motile sperm domain containing 3
Horse(100067442) motile sperm domain containing 3
domestic cat(101092224) motile sperm domain containing 3
dog(608423) motile sperm domain containing 3
domestic guinea pig(100713195) motile sperm domain containing 3
naked mole-rat(101714936) motile sperm domain containing 3
Goat(100861012) motile sperm domain containing 3
sheep(101103615) motile sperm domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030037 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030037 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030037 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_023948 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023948 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023948 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040097 Rosetta Predictions human pricing
NM_001040098 Rosetta Predictions human pricing
NM_001040099 Rosetta Predictions human pricing
NM_023948 Rosetta Predictions human pricing
NM_001025629 Rosetta Predictions rat pricing
NM_030037 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083495 predicted 832
2 SASI_Hs01_00083496 predicted 834
3 SASI_Hs01_00083497 predicted 718
4 SASI_Hs01_00083498 predicted 810
5 SASI_Hs01_00083500 predicted 800
6 SASI_Hs01_00083501 predicted 807
7 SASI_Hs01_00083502 predicted 810
8 SASI_Hs01_00083503 predicted 814
9 SASI_Hs01_00083504 predicted 765
10 SASI_Hs02_00308815 predicted 781
11 SASI_Hs01_00083499 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028511 predicted 747
2 SASI_Hs01_00028512 predicted 744
3 SASI_Hs01_00028513 predicted 633
4 SASI_Hs01_00028514 predicted 723
5 SASI_Hs01_00028516 predicted 707
6 SASI_Hs01_00028517 predicted 727
7 SASI_Hs01_00028518 predicted 722
8 SASI_Hs01_00028519 predicted 731
9 SASI_Hs01_00028520 predicted 677
10 SASI_Hs02_00308816 predicted 696
11 SASI_Hs01_00028515 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084759 predicted 896
2 SASI_Hs01_00084760 predicted 895
3 SASI_Hs01_00084761 predicted 782
4 SASI_Hs01_00084762 predicted 873
5 SASI_Hs01_00084764 predicted 866
6 SASI_Hs01_00084765 predicted 874
7 SASI_Hs01_00084766 predicted 877
8 SASI_Hs01_00084767 predicted 882
9 SASI_Hs01_00084768 predicted 834
10 SASI_Hs02_00308817 predicted 857
11 SASI_Hs01_00084763 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038593 predicted 931
2 SASI_Hs01_00038594 predicted 931
3 SASI_Hs01_00038595 predicted 817
4 SASI_Hs01_00038596 predicted 903
5 SASI_Hs01_00038598 predicted 893
6 SASI_Hs01_00038599 predicted 902
7 SASI_Hs01_00038600 predicted 905
8 SASI_Hs01_00038601 predicted 918
9 SASI_Hs01_00038602 predicted 856
10 SASI_Hs02_00356420 predicted 888
11 SASI_Hs01_00038597 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063607 predicted 385
2 SASI_Rn01_00063608 predicted 383
3 SASI_Rn01_00063609 predicted 451
4 SASI_Rn01_00063610 predicted 212
5 SASI_Rn01_00063611 predicted 343
6 SASI_Rn01_00063612 predicted 448
7 SASI_Rn01_00063613 predicted 316
8 SASI_Rn01_00063614 predicted 428
9 SASI_Rn01_00063615 predicted 307
10 SASI_Rn02_00203189 predicted 339
11 SASI_Rn01_00063606 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030037 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065078 predicted 672
2 SASI_Mm02_00336406 predicted 854
3 SASI_Mm01_00065079 predicted 625
4 SASI_Mm01_00065080 predicted 1118
5 SASI_Mm01_00065081 predicted 601
6 SASI_Mm01_00065082 predicted 1013
7 SASI_Mm01_00065083 predicted 756
8 SASI_Mm01_00065084 predicted 583
9 SASI_Mm01_00065085 predicted 1129
10 SASI_Mm01_00065086 predicted 627
11 SASI_Mm01_00065087 predicted 857
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030037
VALIDATED
MOSPD3 MISSION shRNA Bacterial Glycerol Stock
motile sperm domain containing 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030037.1-630s21c1
Sequence:CCGGCTCAGTCCTGCATTGACATTGCTCGAGCAATGTCAATGCAGGACTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030037.1-586s21c1
Sequence:CCGGACCTGCCAAATACACGGTATTCTCGAGAATACCGTGTATTTGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030037.1-683s21c1
Sequence:CCGGTATGACGTCCAGGACAGATTCCTCGAGGAATCTGTCCTGGACGTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030037.1-1128s21c1
Sequence:CCGGAGGCAGCCACTGTGATGTTTGCTCGAGCAAACATCACAGTGGCTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030037.1-590s1c1
Sequence:CCGGGCCAAATACACGGTATTCGATCTCGAGATCGAATACCGTGTATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030037.1-602s1c1
Sequence:CCGGGTATTCGATGCAGAGGGATATCTCGAGATATCCCTCTGCATCGAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030037.1-587s1c1
Sequence:CCGGCCTGCCAAATACACGGTATTCCTCGAGGAATACCGTGTATTTGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030037
VALIDATED
MOSPD3 MISSION shRNA shRNA Plasmid DNA
motile sperm domain containing 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030037.1-630s21c1
Sequence:CCGGCTCAGTCCTGCATTGACATTGCTCGAGCAATGTCAATGCAGGACTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030037.1-586s21c1
Sequence:CCGGACCTGCCAAATACACGGTATTCTCGAGAATACCGTGTATTTGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030037.1-683s21c1
Sequence:CCGGTATGACGTCCAGGACAGATTCCTCGAGGAATCTGTCCTGGACGTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030037.1-1128s21c1
Sequence:CCGGAGGCAGCCACTGTGATGTTTGCTCGAGCAAACATCACAGTGGCTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030037.1-590s1c1
Sequence:CCGGGCCAAATACACGGTATTCGATCTCGAGATCGAATACCGTGTATTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030037.1-602s1c1
Sequence:CCGGGTATTCGATGCAGAGGGATATCTCGAGATATCCCTCTGCATCGAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030037.1-587s1c1
Sequence:CCGGCCTGCCAAATACACGGTATTCCTCGAGGAATACCGTGTATTTGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030037
VALIDATED
MOSPD3 MISSION shRNA Lentiviral Transduction Particles
motile sperm domain containing 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030037.1-630s21c1
Sequence:CCGGCTCAGTCCTGCATTGACATTGCTCGAGCAATGTCAATGCAGGACTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030037.1-586s21c1
Sequence:CCGGACCTGCCAAATACACGGTATTCTCGAGAATACCGTGTATTTGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030037.1-683s21c1
Sequence:CCGGTATGACGTCCAGGACAGATTCCTCGAGGAATCTGTCCTGGACGTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030037.1-1128s21c1
Sequence:CCGGAGGCAGCCACTGTGATGTTTGCTCGAGCAAACATCACAGTGGCTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030037.1-590s1c1
Sequence:CCGGGCCAAATACACGGTATTCGATCTCGAGATCGAATACCGTGTATTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030037.1-602s1c1
Sequence:CCGGGTATTCGATGCAGAGGGATATCTCGAGATATCCCTCTGCATCGAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030037.1-587s1c1
Sequence:CCGGCCTGCCAAATACACGGTATTCCTCGAGGAATACCGTGTATTTGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023948
MOSPD3 MISSION shRNA Bacterial Glycerol Stock
motile sperm domain containing 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023948.4-1066s21c1
Sequence:CCGGCCACTGTGATGCTCATACCTTCTCGAGAAGGTATGAGCATCACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023948.4-675s21c1
Sequence:CCGGTGGTGGGACGCAAGGACATTACTCGAGTAATGTCCTTGCGTCCCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023948.4-522s21c1
Sequence:CCGGCTGCCAAATACACGGTGTTTGCTCGAGCAAACACCGTGTATTTGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023948.4-564s21c1
Sequence:CCGGCCCAGTCTTGCATTGACATTGCTCGAGCAATGTCAATGCAAGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023948.4-457s21c1
Sequence:CCGGACAGCTGCTGACCCTCTATAACTCGAGTTATAGAGGGTCAGCAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155738    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023948.3-1047s1c1
Sequence:CCGGCCACTGTGATGCTCATACCTTCTCGAGAAGGTATGAGCATCACAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023948.3-502s1c1
Sequence:CCGGCCTGCCAAATACACGGTGTTTCTCGAGAAACACCGTGTATTTGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023948.3-664s1c1
Sequence:CCGGCGCAAGGACATTACCTCCATTCTCGAGAATGGAGGTAATGTCCTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023948
MOSPD3 MISSION shRNA shRNA Plasmid DNA
motile sperm domain containing 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023948.4-1066s21c1
Sequence:CCGGCCACTGTGATGCTCATACCTTCTCGAGAAGGTATGAGCATCACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023948.4-675s21c1
Sequence:CCGGTGGTGGGACGCAAGGACATTACTCGAGTAATGTCCTTGCGTCCCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023948.4-522s21c1
Sequence:CCGGCTGCCAAATACACGGTGTTTGCTCGAGCAAACACCGTGTATTTGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023948.4-564s21c1
Sequence:CCGGCCCAGTCTTGCATTGACATTGCTCGAGCAATGTCAATGCAAGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023948.4-457s21c1
Sequence:CCGGACAGCTGCTGACCCTCTATAACTCGAGTTATAGAGGGTCAGCAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155738    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023948.3-1047s1c1
Sequence:CCGGCCACTGTGATGCTCATACCTTCTCGAGAAGGTATGAGCATCACAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023948.3-502s1c1
Sequence:CCGGCCTGCCAAATACACGGTGTTTCTCGAGAAACACCGTGTATTTGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023948.3-664s1c1
Sequence:CCGGCGCAAGGACATTACCTCCATTCTCGAGAATGGAGGTAATGTCCTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023948
MOSPD3 MISSION shRNA Lentiviral Transduction Particles
motile sperm domain containing 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023948.4-1066s21c1
Sequence:CCGGCCACTGTGATGCTCATACCTTCTCGAGAAGGTATGAGCATCACAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023948.4-675s21c1
Sequence:CCGGTGGTGGGACGCAAGGACATTACTCGAGTAATGTCCTTGCGTCCCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023948.4-522s21c1
Sequence:CCGGCTGCCAAATACACGGTGTTTGCTCGAGCAAACACCGTGTATTTGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023948.4-564s21c1
Sequence:CCGGCCCAGTCTTGCATTGACATTGCTCGAGCAATGTCAATGCAAGACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023948.4-457s21c1
Sequence:CCGGACAGCTGCTGACCCTCTATAACTCGAGTTATAGAGGGTCAGCAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155738    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023948.3-1047s1c1
Sequence:CCGGCCACTGTGATGCTCATACCTTCTCGAGAAGGTATGAGCATCACAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023948.3-502s1c1
Sequence:CCGGCCTGCCAAATACACGGTGTTTCTCGAGAAACACCGTGTATTTGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023948.3-664s1c1
Sequence:CCGGCGCAAGGACATTACCTCCATTCTCGAGAATGGAGGTAATGTCCTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)