EMAIL THIS PAGE TO A FRIEND

MOV10

Mov10, Moloney leukemia virus 10, homolog (mouse)

63 Gene Product Result for
Synonyms: fSAP113 gb110
UniProtKB ID: Q9HCE1, Q5JR03, Q8TEF0, Q9BSY3, Q9BUJ9
Gene ID:
Mouse(17454) Moloney leukemia virus 10
Rat(310756) Moloney leukemia virus 10
sheep(101117713) Mov10, Moloney leukemia virus 10, homolog (mouse)
domestic guinea pig(100726800) Mov10, Moloney leukemia virus 10, homolog (mouse)
naked mole-rat(101705303) Mov10, Moloney leukemia virus 10, homolog (mouse)
chicken(419872) Mov10, Moloney leukemia virus 10, homolog (mouse)
domestic cat(101081152) Mov10, Moloney leukemia virus 10, homolog (mouse)
cow(523206) Mov10, Moloney leukemia virus 10, homolog (mouse)
Horse(100059089) Mov10, Moloney leukemia virus 10, homolog (mouse)
dog(483219) Mov10, Moloney leukemia virus 10, homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108507 Anti-MOV10 IgG fraction of antiserum human, bovine, rabbit, pig, horse
immunohistochemistry, western blot pricing
SAB1100141 Anti-MOV10 (111-125) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV36480 Anti-MOV10 antibody produced in rabbit IgG fraction of antiserum horse, bovine, rat, mouse, human, guinea pig, rabbit
immunohistochemistry, western blot pricing
HPA031627 Anti-MOV10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
PLA0195 Rabbit anti-MOV10 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, human
immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020963 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008619 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008619 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008619 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020963 Rosetta Predictions human pricing
NM_001107711 Rosetta Predictions rat pricing
NM_008619 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217850 predicted 1964
2 SASI_Hs01_00217851 predicted 750
3 SASI_Hs01_00217852 predicted 475
4 SASI_Hs01_00217853 predicted 1121
5 SASI_Hs01_00217854 predicted 1908
6 SASI_Hs01_00217855 predicted 1908
7 SASI_Hs01_00217856 predicted 2641
8 SASI_Hs01_00217857 predicted 2323
9 SASI_Hs01_00217858 predicted 2672
10 SASI_Hs02_00354393 predicted 2397
11 SASI_Hs01_00217849 predicted 2399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107711 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231515 predicted 1003
2 SASI_Rn02_00231516 predicted 2420
3 SASI_Rn02_00231517 predicted 846
4 SASI_Rn02_00231518 predicted 1149
5 SASI_Rn02_00231519 predicted 422
6 SASI_Rn02_00231520 predicted 748
7 SASI_Rn02_00231521 predicted 1230
8 SASI_Rn02_00231522 predicted 2522
9 SASI_Rn02_00231523 predicted 265
10 SASI_Rn02_00231524 predicted 1386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008619 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117562 predicted 440
2 SASI_Mm01_00117563 predicted 956
3 SASI_Mm01_00117564 predicted 279
4 SASI_Mm02_00314299 predicted 2147
5 SASI_Mm01_00117565 predicted 1159
6 SASI_Mm01_00117566 predicted 2580
7 SASI_Mm01_00117567 predicted 1236
8 SASI_Mm01_00117569 predicted 1965
9 SASI_Mm01_00117570 predicted 504
10 SASI_Mm02_00314300 predicted 1171
11 SASI_Mm01_00117561 predicted 2438
12 SASI_Mm01_00117568 predicted 455
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020963
VALIDATED
MOV10 MISSION shRNA Bacterial Glycerol Stock
Mov10, Moloney leukemia virus 10, homolog (mouse)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020963.3-1982s21c1
Sequence:CCGGACGTTAGTGGAGGCAATTAAGCTCGAGCTTAATTGCCTCCACTAACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020963.3-425s21c1
Sequence:CCGGGGCCAGTGTTTCGAGAGTTTCCTCGAGGAAACTCTCGAAACACTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020963.1-1298s1c1
Sequence:CCGGCCCATCACATATAAGGGCTTTCTCGAGAAAGCCCTTATATGTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020963.1-191s1c1
Sequence:CCGGCGCGACTTCAAGATCAGCTTTCTCGAGAAAGCTGATCTTGAAGTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_020963.1-2591s1c1
Sequence:CCGGCGTTACTGCATCACCAAACTTCTCGAGAAGTTTGGTGATGCAGTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_020963.1-2394s1c1
Sequence:CCGGCCATCATCTTTCACGGCGTAACTCGAGTTACGCCGTGAAAGATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_020963.1-1390s1c1
Sequence:CCGGGCTGACCTTCAAGGTGAACTTCTCGAGAAGTTCACCTTGAAGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020963
VALIDATED
MOV10 MISSION shRNA shRNA Plasmid DNA
Mov10, Moloney leukemia virus 10, homolog (mouse)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020963.3-1982s21c1
Sequence:CCGGACGTTAGTGGAGGCAATTAAGCTCGAGCTTAATTGCCTCCACTAACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020963.3-425s21c1
Sequence:CCGGGGCCAGTGTTTCGAGAGTTTCCTCGAGGAAACTCTCGAAACACTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020963.1-1298s1c1
Sequence:CCGGCCCATCACATATAAGGGCTTTCTCGAGAAAGCCCTTATATGTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020963.1-191s1c1
Sequence:CCGGCGCGACTTCAAGATCAGCTTTCTCGAGAAAGCTGATCTTGAAGTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_020963.1-2591s1c1
Sequence:CCGGCGTTACTGCATCACCAAACTTCTCGAGAAGTTTGGTGATGCAGTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_020963.1-2394s1c1
Sequence:CCGGCCATCATCTTTCACGGCGTAACTCGAGTTACGCCGTGAAAGATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_020963.1-1390s1c1
Sequence:CCGGGCTGACCTTCAAGGTGAACTTCTCGAGAAGTTCACCTTGAAGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020963
VALIDATED
MOV10 MISSION shRNA Lentiviral Transduction Particles
Mov10, Moloney leukemia virus 10, homolog (mouse)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020963.3-1982s21c1
Sequence:CCGGACGTTAGTGGAGGCAATTAAGCTCGAGCTTAATTGCCTCCACTAACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020963.3-425s21c1
Sequence:CCGGGGCCAGTGTTTCGAGAGTTTCCTCGAGGAAACTCTCGAAACACTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020963.1-1298s1c1
Sequence:CCGGCCCATCACATATAAGGGCTTTCTCGAGAAAGCCCTTATATGTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020963.1-191s1c1
Sequence:CCGGCGCGACTTCAAGATCAGCTTTCTCGAGAAAGCTGATCTTGAAGTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_020963.1-2591s1c1
Sequence:CCGGCGTTACTGCATCACCAAACTTCTCGAGAAGTTTGGTGATGCAGTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_020963.1-2394s1c1
Sequence:CCGGCCATCATCTTTCACGGCGTAACTCGAGTTACGCCGTGAAAGATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_020963.1-1390s1c1
Sequence:CCGGGCTGACCTTCAAGGTGAACTTCTCGAGAAGTTCACCTTGAAGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008619
VALIDATED
MOV10 MISSION shRNA Bacterial Glycerol Stock
Mov10, Moloney leukemia virus 10, homolog (mouse)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008619.1-2294s21c1
Sequence:CCGGCGCCTACAACTCCTTGTATAACTCGAGTTATACAAGGAGTTGTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008619.1-1018s21c1
Sequence:CCGGGCTATGAACTAGAGCTAAGTTCTCGAGAACTTAGCTCTAGTTCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008619.1-3215s21c1
Sequence:CCGGCCAAGCCTTATTGCTGCCTATCTCGAGATAGGCAGCAATAAGGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008619.1-2012s1c1
Sequence:CCGGGCAGCAATATCGGGTCTTAATCTCGAGATTAAGACCCGATATTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008619.1-2294s1c1
Sequence:CCGGCGCCTACAACTCCTTGTATAACTCGAGTTATACAAGGAGTTGTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008619.1-1018s1c1
Sequence:CCGGGCTATGAACTAGAGCTAAGTTCTCGAGAACTTAGCTCTAGTTCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008619.1-2292s1c1
Sequence:CCGGCTCGCCTACAACTCCTTGTATCTCGAGATACAAGGAGTTGTAGGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008619.1-3215s1c1
Sequence:CCGGCCAAGCCTTATTGCTGCCTATCTCGAGATAGGCAGCAATAAGGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008619.1-2012s21c1
Sequence:CCGGGCAGCAATATCGGGTCTTAATCTCGAGATTAAGACCCGATATTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008619
VALIDATED
MOV10 MISSION shRNA shRNA Plasmid DNA
Mov10, Moloney leukemia virus 10, homolog (mouse)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008619.1-2294s21c1
Sequence:CCGGCGCCTACAACTCCTTGTATAACTCGAGTTATACAAGGAGTTGTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008619.1-1018s21c1
Sequence:CCGGGCTATGAACTAGAGCTAAGTTCTCGAGAACTTAGCTCTAGTTCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008619.1-3215s21c1
Sequence:CCGGCCAAGCCTTATTGCTGCCTATCTCGAGATAGGCAGCAATAAGGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008619.1-2012s1c1
Sequence:CCGGGCAGCAATATCGGGTCTTAATCTCGAGATTAAGACCCGATATTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008619.1-2294s1c1
Sequence:CCGGCGCCTACAACTCCTTGTATAACTCGAGTTATACAAGGAGTTGTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008619.1-1018s1c1
Sequence:CCGGGCTATGAACTAGAGCTAAGTTCTCGAGAACTTAGCTCTAGTTCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008619.1-2292s1c1
Sequence:CCGGCTCGCCTACAACTCCTTGTATCTCGAGATACAAGGAGTTGTAGGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008619.1-3215s1c1
Sequence:CCGGCCAAGCCTTATTGCTGCCTATCTCGAGATAGGCAGCAATAAGGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008619.1-2012s21c1
Sequence:CCGGGCAGCAATATCGGGTCTTAATCTCGAGATTAAGACCCGATATTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008619
VALIDATED
MOV10 MISSION shRNA Lentiviral Transduction Particles
Mov10, Moloney leukemia virus 10, homolog (mouse)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008619.1-2294s21c1
Sequence:CCGGCGCCTACAACTCCTTGTATAACTCGAGTTATACAAGGAGTTGTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008619.1-1018s21c1
Sequence:CCGGGCTATGAACTAGAGCTAAGTTCTCGAGAACTTAGCTCTAGTTCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008619.1-3215s21c1
Sequence:CCGGCCAAGCCTTATTGCTGCCTATCTCGAGATAGGCAGCAATAAGGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008619.1-2012s1c1
Sequence:CCGGGCAGCAATATCGGGTCTTAATCTCGAGATTAAGACCCGATATTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008619.1-2294s1c1
Sequence:CCGGCGCCTACAACTCCTTGTATAACTCGAGTTATACAAGGAGTTGTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008619.1-1018s1c1
Sequence:CCGGGCTATGAACTAGAGCTAAGTTCTCGAGAACTTAGCTCTAGTTCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008619.1-2292s1c1
Sequence:CCGGCTCGCCTACAACTCCTTGTATCTCGAGATACAAGGAGTTGTAGGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008619.1-3215s1c1
Sequence:CCGGCCAAGCCTTATTGCTGCCTATCTCGAGATAGGCAGCAATAAGGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008619.1-2012s21c1
Sequence:CCGGGCAGCAATATCGGGTCTTAATCTCGAGATTAAGACCCGATATTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)