EMAIL THIS PAGE TO A FRIEND

MOV10L1

Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)

49 Gene Product Result for
Synonyms: CHAMP DJ402G11.8
Gene ID:
Human(54456) Summary: This gene is similar to a mouse gene that encodes a putative RNA helicase and shows testis-specific expression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Mouse(83456) Moloney leukemia virus 10-like 1
Rat(300141) Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)
chicken(417738) Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)
domestic cat(101101067) Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)
cow(100139822) Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)
Horse(100056030) Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)
dog(474460) Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)
naked mole-rat(101712351) Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)
Domestic Rabbit(100351875) Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)
domestic guinea pig(100726335) Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)
sheep(101114437) Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018995 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018995 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018995 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018995 Rosetta Predictions human pricing
NM_001106787 Rosetta Predictions rat pricing
NM_031260 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224393 predicted 3211
2 SASI_Hs01_00224394 predicted 317
3 SASI_Hs01_00224396 predicted 3529
4 SASI_Hs01_00224397 predicted 3282
5 SASI_Hs01_00224398 predicted 1889
6 SASI_Hs01_00224399 predicted 1343
7 SASI_Hs01_00224401 predicted 1137
8 SASI_Hs01_00224402 predicted 741
9 SASI_Hs02_00352501 predicted 2358
10 SASI_Hs02_00352502 predicted 2026
11 SASI_Hs01_00224395 predicted 778
12 SASI_Hs01_00224400 predicted 1880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222398 predicted 1605
2 SASI_Rn02_00222399 predicted 1653
3 SASI_Rn02_00222400 predicted 881
4 SASI_Rn02_00222401 predicted 1755
5 SASI_Rn02_00222402 predicted 552
6 SASI_Rn02_00222403 predicted 1326
7 SASI_Rn02_00222404 predicted 1931
8 SASI_Rn02_00222405 predicted 801
9 SASI_Rn02_00222406 predicted 1464
10 SASI_Rn02_00222407 predicted 1633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083285 predicted 1441
2 SASI_Mm01_00083286 predicted 3471
3 SASI_Mm01_00083288 predicted 1768
4 SASI_Mm01_00083289 predicted 2921
5 SASI_Mm01_00083290 predicted 836
6 SASI_Mm01_00083291 predicted 823
7 SASI_Mm01_00083292 predicted 785
8 SASI_Mm02_00337101 predicted 291
9 SASI_Mm01_00083293 predicted 1713
10 SASI_Mm01_00083294 predicted 2624
11 SASI_Mm01_00083287 predicted 1071
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018995
MOV10L1 MISSION shRNA Bacterial Glycerol Stock
Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018995.1-3355s1c1
Sequence:CCGGCGGTCAAATGAAGATAGATTTCTCGAGAAATCTATCTTCATTTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018995.1-3510s1c1
Sequence:CCGGGCTGGAATACAGTATTACAAACTCGAGTTTGTAATACTGTATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018995.1-959s1c1
Sequence:CCGGGCTGGGATAAATCTAAACAATCTCGAGATTGTTTAGATTTATCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018995.1-1974s1c1
Sequence:CCGGCGTCATCCACTTAGGTGTAAACTCGAGTTTACACCTAAGTGGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018995.1-1514s1c1
Sequence:CCGGCCCAATATCCAATCCCAGATACTCGAGTATCTGGGATTGGATATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018995.2-3328s21c1
Sequence:CCGGATGTTGATCTGATGGATATAACTCGAGTTATATCCATCAGATCAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018995.2-2577s21c1
Sequence:CCGGAGGTTCGAGGAGATAGTTATTCTCGAGAATAACTATCTCCTCGAACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018995.2-2642s21c1
Sequence:CCGGAGCCTCACGCTTCCGGATAATCTCGAGATTATCCGGAAGCGTGAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018995.2-1938s21c1
Sequence:CCGGGAATTTGAACAAGCCTATAACCTCGAGGTTATAGGCTTGTTCAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018995.2-217s21c1
Sequence:CCGGCAAGGTACTGCAGCGATTATGCTCGAGCATAATCGCTGCAGTACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018995
MOV10L1 MISSION shRNA shRNA Plasmid DNA
Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018995.1-3355s1c1
Sequence:CCGGCGGTCAAATGAAGATAGATTTCTCGAGAAATCTATCTTCATTTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018995.1-3510s1c1
Sequence:CCGGGCTGGAATACAGTATTACAAACTCGAGTTTGTAATACTGTATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018995.1-959s1c1
Sequence:CCGGGCTGGGATAAATCTAAACAATCTCGAGATTGTTTAGATTTATCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018995.1-1974s1c1
Sequence:CCGGCGTCATCCACTTAGGTGTAAACTCGAGTTTACACCTAAGTGGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018995.1-1514s1c1
Sequence:CCGGCCCAATATCCAATCCCAGATACTCGAGTATCTGGGATTGGATATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018995.2-3328s21c1
Sequence:CCGGATGTTGATCTGATGGATATAACTCGAGTTATATCCATCAGATCAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018995.2-2577s21c1
Sequence:CCGGAGGTTCGAGGAGATAGTTATTCTCGAGAATAACTATCTCCTCGAACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018995.2-2642s21c1
Sequence:CCGGAGCCTCACGCTTCCGGATAATCTCGAGATTATCCGGAAGCGTGAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018995.2-1938s21c1
Sequence:CCGGGAATTTGAACAAGCCTATAACCTCGAGGTTATAGGCTTGTTCAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018995.2-217s21c1
Sequence:CCGGCAAGGTACTGCAGCGATTATGCTCGAGCATAATCGCTGCAGTACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018995
MOV10L1 MISSION shRNA Lentiviral Transduction Particles
Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018995.1-3355s1c1
Sequence:CCGGCGGTCAAATGAAGATAGATTTCTCGAGAAATCTATCTTCATTTGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018995.1-3510s1c1
Sequence:CCGGGCTGGAATACAGTATTACAAACTCGAGTTTGTAATACTGTATTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018995.1-959s1c1
Sequence:CCGGGCTGGGATAAATCTAAACAATCTCGAGATTGTTTAGATTTATCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018995.1-1974s1c1
Sequence:CCGGCGTCATCCACTTAGGTGTAAACTCGAGTTTACACCTAAGTGGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018995.1-1514s1c1
Sequence:CCGGCCCAATATCCAATCCCAGATACTCGAGTATCTGGGATTGGATATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018995.2-3328s21c1
Sequence:CCGGATGTTGATCTGATGGATATAACTCGAGTTATATCCATCAGATCAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018995.2-2577s21c1
Sequence:CCGGAGGTTCGAGGAGATAGTTATTCTCGAGAATAACTATCTCCTCGAACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018995.2-2642s21c1
Sequence:CCGGAGCCTCACGCTTCCGGATAATCTCGAGATTATCCGGAAGCGTGAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018995.2-1938s21c1
Sequence:CCGGGAATTTGAACAAGCCTATAACCTCGAGGTTATAGGCTTGTTCAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018995.2-217s21c1
Sequence:CCGGCAAGGTACTGCAGCGATTATGCTCGAGCATAATCGCTGCAGTACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031260
MOV10L1 MISSION shRNA Bacterial Glycerol Stock
Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031260.1-1465s1c1
Sequence:CCGGCCATGCAGAAATCGAGCTGAACTCGAGTTCAGCTCGATTTCTGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031260.1-2893s1c1
Sequence:CCGGCGGTGCATATAACCCATTGTTCTCGAGAACAATGGGTTATATGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031260.1-3501s1c1
Sequence:CCGGCGCTGCTAGAATACAGTGTTACTCGAGTAACACTGTATTCTAGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031260.1-3724s1c1
Sequence:CCGGGCCTCACCCTATGGGCCATTACTCGAGTAATGGCCCATAGGGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031260.1-268s1c1
Sequence:CCGGCCAGACCACATACTTCTCTTTCTCGAGAAAGAGAAGTATGTGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031260
MOV10L1 MISSION shRNA shRNA Plasmid DNA
Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031260.1-1465s1c1
Sequence:CCGGCCATGCAGAAATCGAGCTGAACTCGAGTTCAGCTCGATTTCTGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031260.1-2893s1c1
Sequence:CCGGCGGTGCATATAACCCATTGTTCTCGAGAACAATGGGTTATATGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031260.1-3501s1c1
Sequence:CCGGCGCTGCTAGAATACAGTGTTACTCGAGTAACACTGTATTCTAGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031260.1-3724s1c1
Sequence:CCGGGCCTCACCCTATGGGCCATTACTCGAGTAATGGCCCATAGGGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031260.1-268s1c1
Sequence:CCGGCCAGACCACATACTTCTCTTTCTCGAGAAAGAGAAGTATGTGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031260
MOV10L1 MISSION shRNA Lentiviral Transduction Particles
Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031260.1-1465s1c1
Sequence:CCGGCCATGCAGAAATCGAGCTGAACTCGAGTTCAGCTCGATTTCTGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031260.1-2893s1c1
Sequence:CCGGCGGTGCATATAACCCATTGTTCTCGAGAACAATGGGTTATATGCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031260.1-3501s1c1
Sequence:CCGGCGCTGCTAGAATACAGTGTTACTCGAGTAACACTGTATTCTAGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031260.1-3724s1c1
Sequence:CCGGGCCTCACCCTATGGGCCATTACTCGAGTAATGGCCCATAGGGTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031260.1-268s1c1
Sequence:CCGGCCAGACCACATACTTCTCTTTCTCGAGAAAGAGAAGTATGTGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)