EMAIL THIS PAGE TO A FRIEND

MOXD1

monooxygenase, DBH-like 1

76 Gene Product Result for
Synonyms: MOX PRO5780 dJ248E1.1
UniProtKB ID: Q6UVY6, Q5THU6, Q8NC97, Q8WV49, Q9H4M6, Q9Y4U3
Gene ID:
Mouse(59012) monooxygenase, DBH-like 1
Rat(294119) monooxygenase, DBH-like 1
Domestic Rabbit(100354039) monooxygenase, DBH-like 1
naked mole-rat(101707565) monooxygenase, DBH-like 1
domestic guinea pig(100726648) monooxygenase, DBH-like 1
sheep(101117937) monooxygenase, DBH-like 1
Zebrafish(570584) monooxygenase, DBH-like 1
domestic cat(101100815) monooxygenase, DBH-like 1
cow(507076) monooxygenase, DBH-like 1
dog(483986) monooxygenase, DBH-like 1
chicken(395333) monooxygenase, DBH-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015529 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021509 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021509 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021509 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031699 Rosetta Predictions human pricing
NM_015529 Rosetta Predictions human pricing
XM_001054130 Rosetta Predictions rat pricing
XM_220095 Rosetta Predictions rat pricing
NM_021509 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095564 predicted 620
2 SASI_Hs01_00095565 predicted 777
3 SASI_Hs01_00095566 predicted 443
4 SASI_Hs01_00095567 predicted 459
5 SASI_Hs01_00095568 predicted 607
6 SASI_Hs01_00095569 predicted 1462
7 SASI_Hs01_00095570 predicted 1843
8 SASI_Hs01_00095571 predicted 1762
9 SASI_Hs01_00095572 predicted 466
10 SASI_Hs01_00095573 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348030 predicted 649
2 SASI_Hs02_00348031 predicted 807
3 SASI_Hs02_00348032 predicted 481
4 SASI_Hs02_00348033 predicted 627
5 SASI_Hs02_00348034 predicted 1350
6 SASI_Hs02_00348035 predicted 1870
7 SASI_Hs02_00348036 predicted 1789
8 SASI_Hs02_00348037 predicted 1983
9 SASI_Hs02_00348038 predicted 1079
10 SASI_Hs02_00348039 predicted 1811
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274868 predicted 578
2 SASI_Rn02_00274869 predicted 655
3 SASI_Rn02_00274870 predicted 410
4 SASI_Rn02_00274871 predicted 1726
5 SASI_Rn02_00274872 predicted 766
6 SASI_Rn02_00274873 predicted 1050
7 SASI_Rn02_00274874 predicted 1321
8 SASI_Rn02_00274875 predicted 1713
9 SASI_Rn02_00274876 predicted 1849
10 SASI_Rn02_00274877 predicted 1561
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379045 predicted 574
2 SASI_Rn02_00379046 predicted 662
3 SASI_Rn02_00379047 predicted 411
4 SASI_Rn02_00379048 predicted 1724
5 SASI_Rn02_00379049 predicted 762
6 SASI_Rn02_00379050 predicted 1058
7 SASI_Rn02_00379051 predicted 1322
8 SASI_Rn02_00379052 predicted 1709
9 SASI_Rn02_00379053 predicted 1848
10 SASI_Rn02_00379054 predicted 1557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110857 predicted 800
2 SASI_Mm02_00326227 predicted 1945
3 SASI_Mm01_00110858 predicted 1692
4 SASI_Mm01_00110859 predicted 1484
5 SASI_Mm01_00110861 predicted 1378
6 SASI_Mm01_00110862 predicted 616
7 SASI_Mm01_00110863 predicted 1715
8 SASI_Mm01_00110864 predicted 388
9 SASI_Mm01_00110865 predicted 1768
10 SASI_Mm01_00110866 predicted 637
11 SASI_Mm01_00110860 predicted 1974
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015529
VALIDATED
MOXD1 MISSION shRNA Bacterial Glycerol Stock
monooxygenase, DBH-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015529.2-351s21c1
Sequence:CCGGGCCCTACCTCCAGGATTATTTCTCGAGAAATAATCCTGGAGGTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015529.2-1988s21c1
Sequence:CCGGTCATTTGAAGTACAGGTTAAACTCGAGTTTAACCTGTACTTCAAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015529.2-606s21c1
Sequence:CCGGGCGGTTATTGAATCCTGAGAACTCGAGTTCTCAGGATTCAATAACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015529.2-994s21c1
Sequence:CCGGCCGCATTATGTGCTCCTAGAACTCGAGTTCTAGGAGCACATAATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015529.2-652s21c1
Sequence:CCGGCCATACTTTGATCTGGTAAATCTCGAGATTTACCAGATCAAAGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015529.1-1727s1c1
Sequence:CCGGCAGATATAGAAAGACCCTATACTCGAGTATAGGGTCTTTCTATATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015529.1-2422s1c1
Sequence:CCGGCCACTCTGGTTCCCTTGTTTACTCGAGTAAACAAGGGAACCAGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015529.1-919s1c1
Sequence:CCGGCCGCATTATGTGCTCCTAGAACTCGAGTTCTAGGAGCACATAATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015529.1-1726s1c1
Sequence:CCGGCCAGATATAGAAAGACCCTATCTCGAGATAGGGTCTTTCTATATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015529.1-531s1c1
Sequence:CCGGGCGGTTATTGAATCCTGAGAACTCGAGTTCTCAGGATTCAATAACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015529
VALIDATED
MOXD1 MISSION shRNA shRNA Plasmid DNA
monooxygenase, DBH-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015529.2-351s21c1
Sequence:CCGGGCCCTACCTCCAGGATTATTTCTCGAGAAATAATCCTGGAGGTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015529.2-1988s21c1
Sequence:CCGGTCATTTGAAGTACAGGTTAAACTCGAGTTTAACCTGTACTTCAAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015529.2-606s21c1
Sequence:CCGGGCGGTTATTGAATCCTGAGAACTCGAGTTCTCAGGATTCAATAACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015529.2-994s21c1
Sequence:CCGGCCGCATTATGTGCTCCTAGAACTCGAGTTCTAGGAGCACATAATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015529.2-652s21c1
Sequence:CCGGCCATACTTTGATCTGGTAAATCTCGAGATTTACCAGATCAAAGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015529.1-1727s1c1
Sequence:CCGGCAGATATAGAAAGACCCTATACTCGAGTATAGGGTCTTTCTATATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015529.1-2422s1c1
Sequence:CCGGCCACTCTGGTTCCCTTGTTTACTCGAGTAAACAAGGGAACCAGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015529.1-919s1c1
Sequence:CCGGCCGCATTATGTGCTCCTAGAACTCGAGTTCTAGGAGCACATAATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015529.1-1726s1c1
Sequence:CCGGCCAGATATAGAAAGACCCTATCTCGAGATAGGGTCTTTCTATATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015529.1-531s1c1
Sequence:CCGGGCGGTTATTGAATCCTGAGAACTCGAGTTCTCAGGATTCAATAACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015529
VALIDATED
MOXD1 MISSION shRNA Lentiviral Transduction Particles
monooxygenase, DBH-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015529.2-351s21c1
Sequence:CCGGGCCCTACCTCCAGGATTATTTCTCGAGAAATAATCCTGGAGGTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015529.2-1988s21c1
Sequence:CCGGTCATTTGAAGTACAGGTTAAACTCGAGTTTAACCTGTACTTCAAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015529.2-606s21c1
Sequence:CCGGGCGGTTATTGAATCCTGAGAACTCGAGTTCTCAGGATTCAATAACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015529.2-994s21c1
Sequence:CCGGCCGCATTATGTGCTCCTAGAACTCGAGTTCTAGGAGCACATAATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015529.2-652s21c1
Sequence:CCGGCCATACTTTGATCTGGTAAATCTCGAGATTTACCAGATCAAAGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015529.1-1727s1c1
Sequence:CCGGCAGATATAGAAAGACCCTATACTCGAGTATAGGGTCTTTCTATATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015529.1-2422s1c1
Sequence:CCGGCCACTCTGGTTCCCTTGTTTACTCGAGTAAACAAGGGAACCAGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015529.1-919s1c1
Sequence:CCGGCCGCATTATGTGCTCCTAGAACTCGAGTTCTAGGAGCACATAATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015529.1-1726s1c1
Sequence:CCGGCCAGATATAGAAAGACCCTATCTCGAGATAGGGTCTTTCTATATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015529.1-531s1c1
Sequence:CCGGGCGGTTATTGAATCCTGAGAACTCGAGTTCTCAGGATTCAATAACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021509
VALIDATED
MOXD1 MISSION shRNA Bacterial Glycerol Stock
monooxygenase, DBH-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021509.3-596s1c1
Sequence:CCGGCGGTTACTGAATCCTGAGAAACTCGAGTTTCTCAGGATTCAGTAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021509.3-2193s1c1
Sequence:CCGGGCACATCAAGTGGAAAGCAAACTCGAGTTTGCTTTCCACTTGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021509.3-641s1c1
Sequence:CCGGCCGTACTTTGATCTGGTAAATCTCGAGATTTACCAGATCAAAGTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021509.3-1695s1c1
Sequence:CCGGCCTTCAACAAGCTCGTTCTTACTCGAGTAAGAACGAGCTTGTTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021509.3-702s1c1
Sequence:CCGGGCCAAATGTTTAAGATTCCTACTCGAGTAGGAATCTTAAACATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021509
VALIDATED
MOXD1 MISSION shRNA shRNA Plasmid DNA
monooxygenase, DBH-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021509.3-596s1c1
Sequence:CCGGCGGTTACTGAATCCTGAGAAACTCGAGTTTCTCAGGATTCAGTAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021509.3-2193s1c1
Sequence:CCGGGCACATCAAGTGGAAAGCAAACTCGAGTTTGCTTTCCACTTGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021509.3-641s1c1
Sequence:CCGGCCGTACTTTGATCTGGTAAATCTCGAGATTTACCAGATCAAAGTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021509.3-1695s1c1
Sequence:CCGGCCTTCAACAAGCTCGTTCTTACTCGAGTAAGAACGAGCTTGTTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021509.3-702s1c1
Sequence:CCGGGCCAAATGTTTAAGATTCCTACTCGAGTAGGAATCTTAAACATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021509
VALIDATED
MOXD1 MISSION shRNA Lentiviral Transduction Particles
monooxygenase, DBH-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021509.3-596s1c1
Sequence:CCGGCGGTTACTGAATCCTGAGAAACTCGAGTTTCTCAGGATTCAGTAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021509.3-2193s1c1
Sequence:CCGGGCACATCAAGTGGAAAGCAAACTCGAGTTTGCTTTCCACTTGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021509.3-641s1c1
Sequence:CCGGCCGTACTTTGATCTGGTAAATCTCGAGATTTACCAGATCAAAGTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021509.3-1695s1c1
Sequence:CCGGCCTTCAACAAGCTCGTTCTTACTCGAGTAAGAACGAGCTTGTTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021509.3-702s1c1
Sequence:CCGGGCCAAATGTTTAAGATTCCTACTCGAGTAGGAATCTTAAACATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)