EMAIL THIS PAGE TO A FRIEND

MPC1

mitochondrial pyruvate carrier 1

97 Gene Product Result for
Synonyms: BRP44L MPYCD dJ68L15.3
UniProtKB ID: Q9Y5U8, B2R5I7, Q5TI66, Q9HB67, Q9UQN4
Gene ID:
Human(51660) Summary: The protein encoded by this gene is part of an MPC1/MPC2 heterodimer that is responsible for transporting pyruvate into mitochondria. The encoded protein is found in the inner mitochondrial membrane. Defects in this gene are a cause of mitochondrial pyruvate carrier deficiency. Several transcript variants, some protein coding and one non-protein coding, have been found for this gene. [provided by RefSeq, Aug 2012]
Mouse(55951) mitochondrial pyruvate carrier 1
Rat(171087) mitochondrial pyruvate carrier 1
Zebrafish(436671) mitochondrial pyruvate carrier 1
domestic cat(101101569) mitochondrial pyruvate carrier 1
fruit fly(42268) Mitochondrial pyruvate carrier
sheep(101114529) mitochondrial pyruvate carrier 1
domestic guinea pig(100729893) mitochondrial pyruvate carrier 1
naked mole-rat(101709554) mitochondrial pyruvate carrier 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016098 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016098 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016098 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU185541 MISSION® esiRNA esiRNA targeting mouse Brp44l mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016098 Rosetta Predictions human pricing
NM_133561 Rosetta Predictions rat pricing
NM_018819 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085937 predicted 621
2 SASI_Hs01_00085938 predicted 725
3 SASI_Hs02_00348867 predicted 614
4 SASI_Hs01_00085939 predicted 288
5 SASI_Hs01_00085940 predicted 586
6 SASI_Hs01_00085942 predicted 262
7 SASI_Hs01_00085943 predicted 278
8 SASI_Hs01_00085944 predicted 344
9 SASI_Hs01_00085945 predicted 706
10 SASI_Hs02_00348868 predicted 301
11 SASI_Hs01_00085936 predicted 308
12 SASI_Hs01_00085941 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102393 predicted 263
2 SASI_Rn01_00102395 predicted 237
3 SASI_Rn01_00102396 predicted 248
4 SASI_Rn01_00102397 predicted 296
5 SASI_Rn01_00102398 predicted 540
6 SASI_Rn01_00102399 predicted 223
7 SASI_Rn01_00102400 predicted 221
8 SASI_Rn01_00102401 predicted 435
9 SASI_Rn01_00102402 predicted 350
10 SASI_Rn02_00267756 predicted 347
11 SASI_Rn01_00102394 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142610 predicted 220
2 SASI_Mm01_00142612 predicted 573
3 SASI_Mm01_00142613 predicted 259
4 SASI_Mm01_00142614 predicted 472
5 SASI_Mm01_00142615 predicted 563
6 SASI_Mm02_00324161 predicted 571
7 SASI_Mm01_00142617 predicted 241
8 SASI_Mm01_00142618 predicted 230
9 SASI_Mm01_00142619 predicted 359
10 SASI_Mm02_00324162 predicted 362
11 SASI_Mm01_00142611 predicted 678
12 SASI_Mm01_00142616 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016098
VALIDATED
MPC1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial pyruvate carrier 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016098.1-266s1c1
Sequence:CCGGAGAGATTATCAGTGGGCGGATCTCGAGATCCGCCCACTGATAATCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005485    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_016098.1-619s1c1
Sequence:CCGGGCTGCCTTACAAGTATTAAATCTCGAGATTTAATACTTGTAAGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016098.1-237s1c1
Sequence:CCGGGCTGCCATCAATGATATGAAACTCGAGTTTCATATCATTGATGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016098.1-344s1c1
Sequence:CCGGGCCTCGGAACTGGCTTCTGTTCTCGAGAACAGAAGCCAGTTCCGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016098.1-410s1c1
Sequence:CCGGGCGGCTTATCAAACACGAGATCTCGAGATCTCGTGTTTGATAAGCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016098.2-154s21c1
Sequence:CCGGACTATGTCCGAAGCAAGGATTCTCGAGAATCCTTGCTTCGGACATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016098.2-505s21c1
Sequence:CCGGTGAGTCACAGATTTCATTATACTCGAGTATAATGAAATCTGTGACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016098.2-290s21c1
Sequence:CCGGATTTGCCCTCTGTTGCTATTCCTCGAGGAATAGCAACAGAGGGCAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016098
VALIDATED
MPC1 MISSION shRNA shRNA Plasmid DNA
mitochondrial pyruvate carrier 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016098.1-266s1c1
Sequence:CCGGAGAGATTATCAGTGGGCGGATCTCGAGATCCGCCCACTGATAATCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005485    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_016098.1-619s1c1
Sequence:CCGGGCTGCCTTACAAGTATTAAATCTCGAGATTTAATACTTGTAAGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016098.1-237s1c1
Sequence:CCGGGCTGCCATCAATGATATGAAACTCGAGTTTCATATCATTGATGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016098.1-344s1c1
Sequence:CCGGGCCTCGGAACTGGCTTCTGTTCTCGAGAACAGAAGCCAGTTCCGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016098.1-410s1c1
Sequence:CCGGGCGGCTTATCAAACACGAGATCTCGAGATCTCGTGTTTGATAAGCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016098.2-154s21c1
Sequence:CCGGACTATGTCCGAAGCAAGGATTCTCGAGAATCCTTGCTTCGGACATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016098.2-505s21c1
Sequence:CCGGTGAGTCACAGATTTCATTATACTCGAGTATAATGAAATCTGTGACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016098.2-290s21c1
Sequence:CCGGATTTGCCCTCTGTTGCTATTCCTCGAGGAATAGCAACAGAGGGCAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016098
VALIDATED
MPC1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial pyruvate carrier 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016098.1-266s1c1
Sequence:CCGGAGAGATTATCAGTGGGCGGATCTCGAGATCCGCCCACTGATAATCTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005485    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_016098.1-619s1c1
Sequence:CCGGGCTGCCTTACAAGTATTAAATCTCGAGATTTAATACTTGTAAGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016098.1-237s1c1
Sequence:CCGGGCTGCCATCAATGATATGAAACTCGAGTTTCATATCATTGATGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016098.1-344s1c1
Sequence:CCGGGCCTCGGAACTGGCTTCTGTTCTCGAGAACAGAAGCCAGTTCCGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016098.1-410s1c1
Sequence:CCGGGCGGCTTATCAAACACGAGATCTCGAGATCTCGTGTTTGATAAGCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016098.2-154s21c1
Sequence:CCGGACTATGTCCGAAGCAAGGATTCTCGAGAATCCTTGCTTCGGACATAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016098.2-505s21c1
Sequence:CCGGTGAGTCACAGATTTCATTATACTCGAGTATAATGAAATCTGTGACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016098.2-290s21c1
Sequence:CCGGATTTGCCCTCTGTTGCTATTCCTCGAGGAATAGCAACAGAGGGCAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018819
MPC1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial pyruvate carrier 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018819.3-288s1c1
Sequence:CCGGCCTACAAGGTACAACCTCGAACTCGAGTTCGAGGTTGTACCTTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018819.4-691s21c1
Sequence:CCGGCTATTGGGATTTGTGTAATAACTCGAGTTATTACACAAATCCCAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018819.4-229s21c1
Sequence:CCGGATCAGTGGGCGGATGACTTTCCTCGAGGAAAGTCATCCGCCCACTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018819.4-578s21c1
Sequence:CCGGATCAATGCTAAACCTTATTTGCTCGAGCAAATAAGGTTTAGCATTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018819.3-336s1c1
Sequence:CCGGCAAACGAAGTAGCTCAGCTCACTCGAGTGAGCTGAGCTACTTCGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018819.3-323s1c1
Sequence:CCGGGCATGCCATGTAACAAACGAACTCGAGTTCGTTTGTTACATGGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018819.3-371s1c1
Sequence:CCGGCTTATCAACTACGAGATGAGTCTCGAGACTCATCTCGTAGTTGATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018819.3-256s1c1
Sequence:CCGGCTGTTGCTATTCTCTGACATTCTCGAGAATGTCAGAGAATAGCAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018819.4-123s21c1
Sequence:CCGGCAAGGACTTCCGGGACTATCTCTCGAGAGATAGTCCCGGAAGTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018819.4-660s21c1
Sequence:CCGGCTATAGCAATCTGTAGTAATACTCGAGTATTACTACAGATTGCTATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018819
MPC1 MISSION shRNA shRNA Plasmid DNA
mitochondrial pyruvate carrier 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018819.3-288s1c1
Sequence:CCGGCCTACAAGGTACAACCTCGAACTCGAGTTCGAGGTTGTACCTTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018819.4-691s21c1
Sequence:CCGGCTATTGGGATTTGTGTAATAACTCGAGTTATTACACAAATCCCAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018819.4-229s21c1
Sequence:CCGGATCAGTGGGCGGATGACTTTCCTCGAGGAAAGTCATCCGCCCACTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018819.4-578s21c1
Sequence:CCGGATCAATGCTAAACCTTATTTGCTCGAGCAAATAAGGTTTAGCATTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018819.3-336s1c1
Sequence:CCGGCAAACGAAGTAGCTCAGCTCACTCGAGTGAGCTGAGCTACTTCGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018819.3-323s1c1
Sequence:CCGGGCATGCCATGTAACAAACGAACTCGAGTTCGTTTGTTACATGGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018819.3-371s1c1
Sequence:CCGGCTTATCAACTACGAGATGAGTCTCGAGACTCATCTCGTAGTTGATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018819.3-256s1c1
Sequence:CCGGCTGTTGCTATTCTCTGACATTCTCGAGAATGTCAGAGAATAGCAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018819.4-123s21c1
Sequence:CCGGCAAGGACTTCCGGGACTATCTCTCGAGAGATAGTCCCGGAAGTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018819.4-660s21c1
Sequence:CCGGCTATAGCAATCTGTAGTAATACTCGAGTATTACTACAGATTGCTATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018819
MPC1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial pyruvate carrier 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018819.3-288s1c1
Sequence:CCGGCCTACAAGGTACAACCTCGAACTCGAGTTCGAGGTTGTACCTTGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018819.4-691s21c1
Sequence:CCGGCTATTGGGATTTGTGTAATAACTCGAGTTATTACACAAATCCCAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018819.4-229s21c1
Sequence:CCGGATCAGTGGGCGGATGACTTTCCTCGAGGAAAGTCATCCGCCCACTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018819.4-578s21c1
Sequence:CCGGATCAATGCTAAACCTTATTTGCTCGAGCAAATAAGGTTTAGCATTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018819.3-336s1c1
Sequence:CCGGCAAACGAAGTAGCTCAGCTCACTCGAGTGAGCTGAGCTACTTCGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018819.3-323s1c1
Sequence:CCGGGCATGCCATGTAACAAACGAACTCGAGTTCGTTTGTTACATGGCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018819.3-371s1c1
Sequence:CCGGCTTATCAACTACGAGATGAGTCTCGAGACTCATCTCGTAGTTGATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018819.3-256s1c1
Sequence:CCGGCTGTTGCTATTCTCTGACATTCTCGAGAATGTCAGAGAATAGCAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018819.4-123s21c1
Sequence:CCGGCAAGGACTTCCGGGACTATCTCTCGAGAGATAGTCCCGGAAGTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018819.4-660s21c1
Sequence:CCGGCTATAGCAATCTGTAGTAATACTCGAGTATTACTACAGATTGCTATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)