EMAIL THIS PAGE TO A FRIEND

MPC2

mitochondrial pyruvate carrier 2

47 Gene Product Result for
Synonyms: BRP44
UniProtKB ID: O95563, A8K261, Q3SXR6, Q6FIF3
Gene ID:
Mouse(70456) mitochondrial pyruvate carrier 2
Rat(100359982) mitochondrial pyruvate carrier 2
Zebrafish(321611) mitochondrial pyruvate carrier 2
domestic cat(101099352) mitochondrial pyruvate carrier 2
naked mole-rat(101726246) mitochondrial pyruvate carrier 2
domestic guinea pig(100713365) mitochondrial pyruvate carrier 2
sheep(101115921) mitochondrial pyruvate carrier 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015415 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027430 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027430 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027430 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015415 Rosetta Predictions human pricing
NM_027430 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137621 predicted 298
2 SASI_Hs01_00137622 predicted 426
3 SASI_Hs01_00137623 predicted 210
4 SASI_Hs02_00347784 predicted 557
5 SASI_Hs01_00137626 predicted 216
6 SASI_Hs01_00137627 predicted 226
7 SASI_Hs01_00137628 predicted 520
8 SASI_Hs02_00347785 predicted 245
9 SASI_Hs02_00347786 predicted 354
10 SASI_Hs02_00347787 predicted 402
11 SASI_Hs01_00137624 predicted 404
12 SASI_Hs01_00137625 predicted 547
13 SASI_Hs01_00137629 predicted 386
14 SASI_Hs01_00137630 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117154 predicted 626
2 SASI_Mm01_00117156 predicted 545
3 SASI_Mm01_00117158 predicted 592
4 SASI_Mm01_00117159 predicted 544
5 SASI_Mm01_00117160 predicted 434
6 SASI_Mm01_00117161 predicted 397
7 SASI_Mm02_00332184 predicted 390
8 SASI_Mm01_00117162 predicted 565
9 SASI_Mm02_00332185 predicted 520
10 SASI_Mm02_00332186 predicted 571
11 SASI_Mm01_00117153 predicted 598
12 SASI_Mm01_00117155 predicted 591
13 SASI_Mm01_00117157 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015415
VALIDATED
MPC2 MISSION shRNA Bacterial Glycerol Stock
mitochondrial pyruvate carrier 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015415.2-387s21c1
Sequence:CCGGCAGGGTTTATTTGGTCAAGATCTCGAGATCTTGACCAAATAAACCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015415.1-645s1c1
Sequence:CCGGGCACTGTAACTGGTAGCTAGTCTCGAGACTAGCTACCAGTTACAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015415.1-390s1c1
Sequence:CCGGCAGGGTTTATTTGGTCAAGATCTCGAGATCTTGACCAAATAAACCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015415.2-642s21c1
Sequence:CCGGGCACTGTAACTGGTAGCTAGTCTCGAGACTAGCTACCAGTTACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015415.1-620s1c1
Sequence:CCGGGCAAAGCTAACTGTGTGTTTACTCGAGTAAACACACAGTTAGCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015415.1-382s1c1
Sequence:CCGGGATGGCTACAGGGTTTATTTGCTCGAGCAAATAAACCCTGTAGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015415.2-400s21c1
Sequence:CCGGGTCAAGATACTCACTTGTAATCTCGAGATTACAAGTGAGTATCTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015415.2-617s21c1
Sequence:CCGGGCAAAGCTAACTGTGTGTTTACTCGAGTAAACACACAGTTAGCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015415.1-232s1c1
Sequence:CCGGCGAGAAATTGAGGCCGTTGTACTCGAGTACAACGGCCTCAATTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015415.1-403s1c1
Sequence:CCGGGTCAAGATACTCACTTGTAATCTCGAGATTACAAGTGAGTATCTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015415
VALIDATED
MPC2 MISSION shRNA shRNA Plasmid DNA
mitochondrial pyruvate carrier 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015415.2-387s21c1
Sequence:CCGGCAGGGTTTATTTGGTCAAGATCTCGAGATCTTGACCAAATAAACCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015415.1-645s1c1
Sequence:CCGGGCACTGTAACTGGTAGCTAGTCTCGAGACTAGCTACCAGTTACAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015415.1-390s1c1
Sequence:CCGGCAGGGTTTATTTGGTCAAGATCTCGAGATCTTGACCAAATAAACCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015415.2-642s21c1
Sequence:CCGGGCACTGTAACTGGTAGCTAGTCTCGAGACTAGCTACCAGTTACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015415.1-620s1c1
Sequence:CCGGGCAAAGCTAACTGTGTGTTTACTCGAGTAAACACACAGTTAGCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015415.1-382s1c1
Sequence:CCGGGATGGCTACAGGGTTTATTTGCTCGAGCAAATAAACCCTGTAGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015415.2-400s21c1
Sequence:CCGGGTCAAGATACTCACTTGTAATCTCGAGATTACAAGTGAGTATCTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015415.2-617s21c1
Sequence:CCGGGCAAAGCTAACTGTGTGTTTACTCGAGTAAACACACAGTTAGCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015415.1-232s1c1
Sequence:CCGGCGAGAAATTGAGGCCGTTGTACTCGAGTACAACGGCCTCAATTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015415.1-403s1c1
Sequence:CCGGGTCAAGATACTCACTTGTAATCTCGAGATTACAAGTGAGTATCTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015415
VALIDATED
MPC2 MISSION shRNA Lentiviral Transduction Particles
mitochondrial pyruvate carrier 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015415.2-387s21c1
Sequence:CCGGCAGGGTTTATTTGGTCAAGATCTCGAGATCTTGACCAAATAAACCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015415.1-645s1c1
Sequence:CCGGGCACTGTAACTGGTAGCTAGTCTCGAGACTAGCTACCAGTTACAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015415.1-390s1c1
Sequence:CCGGCAGGGTTTATTTGGTCAAGATCTCGAGATCTTGACCAAATAAACCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015415.2-642s21c1
Sequence:CCGGGCACTGTAACTGGTAGCTAGTCTCGAGACTAGCTACCAGTTACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015415.1-620s1c1
Sequence:CCGGGCAAAGCTAACTGTGTGTTTACTCGAGTAAACACACAGTTAGCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015415.1-382s1c1
Sequence:CCGGGATGGCTACAGGGTTTATTTGCTCGAGCAAATAAACCCTGTAGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015415.2-400s21c1
Sequence:CCGGGTCAAGATACTCACTTGTAATCTCGAGATTACAAGTGAGTATCTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015415.2-617s21c1
Sequence:CCGGGCAAAGCTAACTGTGTGTTTACTCGAGTAAACACACAGTTAGCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015415.1-232s1c1
Sequence:CCGGCGAGAAATTGAGGCCGTTGTACTCGAGTACAACGGCCTCAATTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015415.1-403s1c1
Sequence:CCGGGTCAAGATACTCACTTGTAATCTCGAGATTACAAGTGAGTATCTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027430
VALIDATED
MPC2 MISSION shRNA Bacterial Glycerol Stock
mitochondrial pyruvate carrier 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027430.1-531s1c1
Sequence:CCGGCTGTTTCGGATTTGGAGATATCTCGAGATATCTCCAAATCCGAAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027430.2-232s21c1
Sequence:CCGGTACCACCGACTCATGGATAAACTCGAGTTTATCCATGAGTCGGTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027430.1-273s1c1
Sequence:CCGGCCAAAGAAATTGAGGCCGCTTCTCGAGAAGCGGCCTCAATTTCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027430.2-528s21c1
Sequence:CCGGGTTTCGGATTTGGAGATATAACTCGAGTTATATCTCCAAATCCGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027430.2-418s21c1
Sequence:CCGGTTGATGGCTACAGGGTTTATTCTCGAGAATAAACCCTGTAGCCATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027430.2-474s21c1
Sequence:CCGGTTGGAGTTTGTTCGCTGTTAACTCGAGTTAACAGCGAACAAACTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027430.2-647s21c1
Sequence:CCGGCCGATAAGGTGATGCTAAATTCTCGAGAATTTAGCATCACCTTATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027430
VALIDATED
MPC2 MISSION shRNA shRNA Plasmid DNA
mitochondrial pyruvate carrier 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027430.1-531s1c1
Sequence:CCGGCTGTTTCGGATTTGGAGATATCTCGAGATATCTCCAAATCCGAAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027430.2-232s21c1
Sequence:CCGGTACCACCGACTCATGGATAAACTCGAGTTTATCCATGAGTCGGTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027430.1-273s1c1
Sequence:CCGGCCAAAGAAATTGAGGCCGCTTCTCGAGAAGCGGCCTCAATTTCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027430.2-528s21c1
Sequence:CCGGGTTTCGGATTTGGAGATATAACTCGAGTTATATCTCCAAATCCGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027430.2-418s21c1
Sequence:CCGGTTGATGGCTACAGGGTTTATTCTCGAGAATAAACCCTGTAGCCATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027430.2-474s21c1
Sequence:CCGGTTGGAGTTTGTTCGCTGTTAACTCGAGTTAACAGCGAACAAACTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027430.2-647s21c1
Sequence:CCGGCCGATAAGGTGATGCTAAATTCTCGAGAATTTAGCATCACCTTATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027430
VALIDATED
MPC2 MISSION shRNA Lentiviral Transduction Particles
mitochondrial pyruvate carrier 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027430.1-531s1c1
Sequence:CCGGCTGTTTCGGATTTGGAGATATCTCGAGATATCTCCAAATCCGAAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027430.2-232s21c1
Sequence:CCGGTACCACCGACTCATGGATAAACTCGAGTTTATCCATGAGTCGGTGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027430.1-273s1c1
Sequence:CCGGCCAAAGAAATTGAGGCCGCTTCTCGAGAAGCGGCCTCAATTTCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027430.2-528s21c1
Sequence:CCGGGTTTCGGATTTGGAGATATAACTCGAGTTATATCTCCAAATCCGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027430.2-418s21c1
Sequence:CCGGTTGATGGCTACAGGGTTTATTCTCGAGAATAAACCCTGTAGCCATCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027430.2-474s21c1
Sequence:CCGGTTGGAGTTTGTTCGCTGTTAACTCGAGTTAACAGCGAACAAACTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027430.2-647s21c1
Sequence:CCGGCCGATAAGGTGATGCTAAATTCTCGAGAATTTAGCATCACCTTATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)