EMAIL THIS PAGE TO A FRIEND

MPDU1

mannose-P-dolichol utilization defect 1

79 Gene Product Result for
Synonyms: CDGIF HBEBP2BPA Lec35 My008 PP3958 PQLC5 SL15
UniProtKB ID: O75352, B3KQP1, Q9BUU8
Gene ID:
Human(9526) Summary: This gene encodes an endoplasmic reticulum membrane protein that is required for utilization of the mannose donor mannose-P-dolichol in the synthesis of lipid-linked oligosaccharides and glycosylphosphatidylinositols. Mutations in this gene result in congenital disorder of glycosylation type If. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Mouse(24070) mannose-P-dolichol utilization defect 1
Rat(303244) mannose-P-dolichol utilization defect 1
Horse(100062007) mannose-P-dolichol utilization defect 1
cow(504961) mannose-P-dolichol utilization defect 1
domestic cat(101098754) mannose-P-dolichol utilization defect 1
dog(489477) mannose-P-dolichol utilization defect 1
sheep(101102251) mannose-P-dolichol utilization defect 1
domestic guinea pig(100736101) mannose-P-dolichol utilization defect 1
naked mole-rat(101698908) mannose-P-dolichol utilization defect 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011900 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011900 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011900 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004870 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004870 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004870 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004870 Rosetta Predictions human pricing
NM_001107011 Rosetta Predictions rat pricing
NM_011900 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191686 predicted 801
2 SASI_Hs01_00191689 predicted 1012
3 SASI_Hs02_00338495 predicted 1084
4 SASI_Hs02_00338496 predicted 524
5 SASI_Hs01_00191691 predicted 692
6 SASI_Hs01_00191692 predicted 249
7 SASI_Hs01_00191694 predicted 420
8 SASI_Hs02_00338497 predicted 428
9 SASI_Hs02_00338498 predicted 304
10 SASI_Hs02_00338499 predicted 272
11 SASI_Hs01_00191687 predicted 996
12 SASI_Hs01_00191688 predicted 1054
13 SASI_Hs01_00191690 predicted 860
14 SASI_Hs01_00191693 predicted 535
15 SASI_Hs01_00191695 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107011 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224606 predicted 581
2 SASI_Rn02_00224607 predicted 778
3 SASI_Rn02_00224608 predicted 782
4 SASI_Rn02_00224609 predicted 832
5 SASI_Rn02_00224610 predicted 384
6 SASI_Rn02_00224611 predicted 411
7 SASI_Rn02_00224612 predicted 371
8 SASI_Rn02_00224613 predicted 803
9 SASI_Rn02_00224614 predicted 559
10 SASI_Rn02_00224615 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011900 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123282 predicted 612
2 SASI_Mm01_00123283 predicted 764
3 SASI_Mm01_00123284 predicted 672
4 SASI_Mm01_00123285 predicted 665
5 SASI_Mm01_00123287 predicted 868
6 SASI_Mm01_00123288 predicted 440
7 SASI_Mm01_00123289 predicted 666
8 SASI_Mm01_00123290 predicted 1000
9 SASI_Mm01_00123291 predicted 591
10 SASI_Mm02_00321710 predicted 327
11 SASI_Mm01_00123286 predicted 281
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011900
VALIDATED
MPDU1 MISSION shRNA Bacterial Glycerol Stock
mannose-P-dolichol utilization defect 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011900.2-624s1c1
Sequence:CCGGGCTTTCAGCCATTACAGTGTTCTCGAGAACACTGTAATGGCTGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217476    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011900.3-820s1c1
Sequence:CCGGGAGCTCGCTTCTAGAACAATTCTCGAGAATTGTTCTAGAAGCGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011900.3-663s21c1
Sequence:CCGGTTGGCCCGAATCTTCACTTCTCTCGAGAGAAGTGAAGATTCGGGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011900.3-579s21c1
Sequence:CCGGTTGCTTCAGGCAGCCACTAACCTCGAGGTTAGTGGCTGCCTGAAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011900.3-765s21c1
Sequence:CCGGCTCTTCTACTGGAACGCAAAGCTCGAGCTTTGCGTTCCAGTAGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011900.3-820s21c1
Sequence:CCGGGAGCTCGCTTCTAGAACAATTCTCGAGAATTGTTCTAGAAGCGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011900.3-616s21c1
Sequence:CCGGCAGGCCAGCTTTCAGCCATTACTCGAGTAATGGCTGAAAGCTGGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011900
VALIDATED
MPDU1 MISSION shRNA shRNA Plasmid DNA
mannose-P-dolichol utilization defect 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011900.2-624s1c1
Sequence:CCGGGCTTTCAGCCATTACAGTGTTCTCGAGAACACTGTAATGGCTGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217476    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011900.3-820s1c1
Sequence:CCGGGAGCTCGCTTCTAGAACAATTCTCGAGAATTGTTCTAGAAGCGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011900.3-663s21c1
Sequence:CCGGTTGGCCCGAATCTTCACTTCTCTCGAGAGAAGTGAAGATTCGGGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011900.3-579s21c1
Sequence:CCGGTTGCTTCAGGCAGCCACTAACCTCGAGGTTAGTGGCTGCCTGAAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011900.3-765s21c1
Sequence:CCGGCTCTTCTACTGGAACGCAAAGCTCGAGCTTTGCGTTCCAGTAGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011900.3-820s21c1
Sequence:CCGGGAGCTCGCTTCTAGAACAATTCTCGAGAATTGTTCTAGAAGCGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011900.3-616s21c1
Sequence:CCGGCAGGCCAGCTTTCAGCCATTACTCGAGTAATGGCTGAAAGCTGGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011900
VALIDATED
MPDU1 MISSION shRNA Lentiviral Transduction Particles
mannose-P-dolichol utilization defect 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011900.2-624s1c1
Sequence:CCGGGCTTTCAGCCATTACAGTGTTCTCGAGAACACTGTAATGGCTGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217476    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011900.3-820s1c1
Sequence:CCGGGAGCTCGCTTCTAGAACAATTCTCGAGAATTGTTCTAGAAGCGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011900.3-663s21c1
Sequence:CCGGTTGGCCCGAATCTTCACTTCTCTCGAGAGAAGTGAAGATTCGGGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011900.3-579s21c1
Sequence:CCGGTTGCTTCAGGCAGCCACTAACCTCGAGGTTAGTGGCTGCCTGAAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011900.3-765s21c1
Sequence:CCGGCTCTTCTACTGGAACGCAAAGCTCGAGCTTTGCGTTCCAGTAGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011900.3-820s21c1
Sequence:CCGGGAGCTCGCTTCTAGAACAATTCTCGAGAATTGTTCTAGAAGCGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011900.3-616s21c1
Sequence:CCGGCAGGCCAGCTTTCAGCCATTACTCGAGTAATGGCTGAAAGCTGGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004870
VALIDATED
MPDU1 MISSION shRNA Bacterial Glycerol Stock
mannose-P-dolichol utilization defect 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004870.1-999s1c1
Sequence:CCGGGCCCTGTACATGTACTATTAACTCGAGTTAATAGTACATGTACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004870.1-295s1c1
Sequence:CCGGCATCACTAACAACTTCCCATTCTCGAGAATGGGAAGTTGTTAGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004870.1-74s1c1
Sequence:CCGGGAGAAATGCTACGACCAACTTCTCGAGAAGTTGGTCGTAGCATTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004870.1-611s1c1
Sequence:CCGGGCCCGAATCTTCACTTCCATTCTCGAGAATGGAAGTGAAGATTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004870.1-128s1c1
Sequence:CCGGCTCAAGATTCTCCTCAGCAAACTCGAGTTTGCTGAGGAGAATCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004870.3-328s21c1
Sequence:CCGGCTCAAGATTCTCCTCAGCAAACTCGAGTTTGCTGAGGAGAATCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004870.3-274s21c1
Sequence:CCGGGAGAAATGCTACGACCAACTTCTCGAGAAGTTGGTCGTAGCATTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004870.3-811s21c1
Sequence:CCGGGCCCGAATCTTCACTTCCATTCTCGAGAATGGAAGTGAAGATTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004870.3-1199s21c1
Sequence:CCGGGCCCTGTACATGTACTATTAACTCGAGTTAATAGTACATGTACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004870
VALIDATED
MPDU1 MISSION shRNA shRNA Plasmid DNA
mannose-P-dolichol utilization defect 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004870.1-999s1c1
Sequence:CCGGGCCCTGTACATGTACTATTAACTCGAGTTAATAGTACATGTACAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004870.1-295s1c1
Sequence:CCGGCATCACTAACAACTTCCCATTCTCGAGAATGGGAAGTTGTTAGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004870.1-74s1c1
Sequence:CCGGGAGAAATGCTACGACCAACTTCTCGAGAAGTTGGTCGTAGCATTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004870.1-611s1c1
Sequence:CCGGGCCCGAATCTTCACTTCCATTCTCGAGAATGGAAGTGAAGATTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004870.1-128s1c1
Sequence:CCGGCTCAAGATTCTCCTCAGCAAACTCGAGTTTGCTGAGGAGAATCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004870.3-328s21c1
Sequence:CCGGCTCAAGATTCTCCTCAGCAAACTCGAGTTTGCTGAGGAGAATCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004870.3-274s21c1
Sequence:CCGGGAGAAATGCTACGACCAACTTCTCGAGAAGTTGGTCGTAGCATTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004870.3-811s21c1
Sequence:CCGGGCCCGAATCTTCACTTCCATTCTCGAGAATGGAAGTGAAGATTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004870.3-1199s21c1
Sequence:CCGGGCCCTGTACATGTACTATTAACTCGAGTTAATAGTACATGTACAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004870
VALIDATED
MPDU1 MISSION shRNA Lentiviral Transduction Particles
mannose-P-dolichol utilization defect 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004870.1-999s1c1
Sequence:CCGGGCCCTGTACATGTACTATTAACTCGAGTTAATAGTACATGTACAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004870.1-295s1c1
Sequence:CCGGCATCACTAACAACTTCCCATTCTCGAGAATGGGAAGTTGTTAGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004870.1-74s1c1
Sequence:CCGGGAGAAATGCTACGACCAACTTCTCGAGAAGTTGGTCGTAGCATTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004870.1-611s1c1
Sequence:CCGGGCCCGAATCTTCACTTCCATTCTCGAGAATGGAAGTGAAGATTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004870.1-128s1c1
Sequence:CCGGCTCAAGATTCTCCTCAGCAAACTCGAGTTTGCTGAGGAGAATCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004870.3-328s21c1
Sequence:CCGGCTCAAGATTCTCCTCAGCAAACTCGAGTTTGCTGAGGAGAATCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004870.3-274s21c1
Sequence:CCGGGAGAAATGCTACGACCAACTTCTCGAGAAGTTGGTCGTAGCATTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004870.3-811s21c1
Sequence:CCGGGCCCGAATCTTCACTTCCATTCTCGAGAATGGAAGTGAAGATTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004870.3-1199s21c1
Sequence:CCGGGCCCTGTACATGTACTATTAACTCGAGTTAATAGTACATGTACAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)